Pobieranie prezentacji. Proszę czekać

Pobieranie prezentacji. Proszę czekać

Związek genotypu receptorów immunoglobulinopodobnych komórek NK (KIR) z występowaniem i przebiegiem klinicznym zesztywniającego zapalenia stawów kręgosłupa.

Podobne prezentacje


Prezentacja na temat: "Związek genotypu receptorów immunoglobulinopodobnych komórek NK (KIR) z występowaniem i przebiegiem klinicznym zesztywniającego zapalenia stawów kręgosłupa."— Zapis prezentacji:

1 Związek genotypu receptorów immunoglobulinopodobnych komórek NK (KIR) z występowaniem i przebiegiem klinicznym zesztywniającego zapalenia stawów kręgosłupa Aleksandra Zoń-Giebel 1, Danuta Kapołka 1, Piotr Sikora 1, Marcin Stajszczyk 1, Eugeniusz Zielonka 1, Edyta Majorczyk 2, Piotr Kusnierczyk 2, Sebastian Giebel 3, Piotr Wiland 4 1 Śląski Szpital Reumatologiczno-Rehabilitacyjny im. Gen. J. Ziętka, Ustr oń 2 Instytut Immunologii i Terapii Doświadczalnej im. L.Hirszfeda, Wrocław 3 Centrum Onkologii Instytut im. M. Skłodowskiej-Curie Oddział w Gliwicach 4 Klinika Reumatologii i Chorób Wewnętrznych AM we Wrocławiu

2 KIR receptory immunoglobulinopodobne komórek zabójców killer immunoglobulin-like receptors Ekspresja: Komórki NK (CD3-CD56+) Komórki NK (CD3-CD56+) Limfocyty T (CD3+CD56-) Limfocyty T (CD3+CD56-) Komórki NKT (CD3+CD56+) Komórki NKT (CD3+CD56+)

3 Genotyp KIR Chromosom 19q13.4 Chromosom 19q genów i 2 pseudogeny 14 genów i 2 pseudogeny Niektóre geny występują w różnych wariantach allelicznych Niektóre geny występują w różnych wariantach allelicznych 4 geny ramowe (zacienione) występują u wszystkich osobników, pozostałe – zmiennie 4 geny ramowe (zacienione) występują u wszystkich osobników, pozostałe – zmiennie

4 KIR – struktura cząsteczkowa Farag, Blood 2002 CYTOPLAZMA

5 Ligandy receptorów KIR Receptory hamująceReceptory aktywujące ReceptorLigandReceptorLigand KIR2DL1HLA-C (grupa C2)KIR2DS1HLA-C (grupa C2) KIR2DL2/3HLA-C (grupa C1)KIR2DS2HLA-C (grupa C1)(?) KIR3DL1HLA-Bw4KIR2DS3HLA-C (grupa C1)(?) KIR3DL2HLA-A3,-A11KIR3DS1HLA-Bw4(?) KIR2DL4 KIR2DL5 KIR3DL3 HLA-G ?? KIR2DS4 KIR2DS5 KIR3DS2 ??

6 Funkcje KIR NK: 1. KIR- podstawowy mechanizm regulacji 2. Interakcja HLA-hamujące KIR chroni prawidłowe komórki organizmu przed atakiem ze strony komórek NK 3. Utrata HLA klasy I lub związnie z określonymi antygenami czyni komórki docelowe wrażliwymi na atak komórek NK (przewaga sygnałów aktywujących) T: 1. Interakcja HLA-hamujące KIR ma działanie immunomodulujące, zmniejsza produkcją cytokin i proliferację, nie wpływając na cytotoksyczność 2. Interakcja HLA-ag-aktywujące KIR – być może obniża próg aktywacji limfocytów T NKT (?)

7 Związek genotypu KIR z występowaniem chorób reumatycznych GenChorobaRef. KIR2DS1+Łuszczycowe zapalenie stawów Williams, Hum Immunol 2005 KIR2DS2+KIR2DL2-Twardzina układowaMomot, Arthritis Rheum 2004 KIR2DS2+Reumatoidalne zapalenie stawów z zapaleniem naczyń Yen, J Exp Med 2001 KIR3DS1+Zesztywniające zapalenie stawów kręgosłupa Lopez-Arrea, Arthritis Res Ther 2006 Brak zależności genotypu KIR i ZZSK Harvey, Ann Rheum Dis 2009

8 Cele: 1. Porównanie częstości występowania poszczególnych genów KIR u chorych na zzsk i w populacji zdrowej. 2. Ustalenie związku występowania poszczególnych genów z przebiegiem klinicznym. Pacjenci: 58 chorych na zzsk leczonych w Szpitalu Reumatologiczno- Rehabilitacyjnym w Ustroniu Kontrola: 243 zdrowe osoby z populacji polskiej

9 Metody: 11 genów KIR oznaczano w grupie badanej i kontrolnej metodą PCR z wykorzytaniem specyficznych dla sekwencji primer-ów. KIR locus Sense (5 3) (Stężenie w reakcji) Antisense (5 3) (Stężenie w reakcji) Rozmiar amplifikacji (bp) KIR2DL1 ccatcagtcgcatgacg (0,5 M) ccactcgtatggagagtcat (0,1 M) 1903 aatgttccgttggaccttggt (0,2 M) 1818 KIR2DL2 acttccttctgcacagagaa (1 M) gccctgcagagaacctaca (1 M) 1868 KIR2DL3 ccttcatcgctggtgctg (0,3 M) caggagacaactttggatca (0,3 M) 812 KIR2DS1 cttctccatcagtcgcatgaa (0,4 M) agagggtcactgggagctgac (0,4 M) 102 cttctccatcagtcgcatgag (0,4 M) KIR2DS2 tgcacagagaggggaagta (1 M)cacgctctctcctgccaa (1 M) 1775 KIR2DS3 tcactccccctatcagttt (2,5 M)gcatctgtaggttcctcct (2,5 M) 1800 KIR2DS4 atcctgcaatgttggtcg (0,4 M) ctggatagatggtacatgtc (0,4 M) 1902 KIR1D atcctgcaatgttggtcg (0,4 M) ctggatagatggagctgca (0,4 M) 1885 KIR2DS5 agagaggggacgtttaacc (1 M)ggaaagagccgaagcatc (1 M) 1952 KIR3DL1 ccatyggtcccatgatgct (1 M) agagag aaggtttctcatatg (1 M) 1690 KIR3DS1 ggcagaatattccaggagg (1 M)aggggtccttagagatcca (1 M) 1765

10 Czynniki brane pod uwagę przy analizie obrazu klinicznego: 1. Przy rozpoznaniu: Wskaźniki aktywności choroby: OB, CRP Postać zzsk Ruchomość kręgosłupa Zajęcie narządu wzroku Zajęcie stawu biodrowego Wiek zachorowania Nasilenie bólu: nocnego, spoczynkowego, związanego z ruchem 2. Przebieg choroby Postać zzsk Zmiany ruchomości kręgosłupa Zmiany nasilenia bólu

11 KIR – ZZSK Wyniki: Locus Pacjenci (%) Kontrola (%) P KIR2DL189,795,9NS KIR2DL251,755,1NS KIR2DL386,292,2NS KIR2DS137,940,3NS KIR2DS256,956,0NS KIR2DS331,028,4NS KIR2DS425,927,8NS KIR1D81,080,2NS KIR2DS513,827,80,03 KIR3DL194,895,9NS KIR3DS125,935,4NS

12

13 P=0,02 P=0,03 P=0,02

14

15

16 WNIOSKI 1. Obecność KIR2DS5 chroni przed występowaniem ZZSK. 2. Obecność poszczególnych aktywujących KIR wiąże się z: - mniejszą aktywnością choroby przy rozpoznaniu, - stabilnym przebiegiem. Powyższe obserwacje wskazują na konieczność przeprowadzenia badań podstawowych ukierunkowanych na ustalenie znaczenia limfocytów wykazujących ekspresję poszczególnych aktywujących KIR w patogenezie ZZSK.


Pobierz ppt "Związek genotypu receptorów immunoglobulinopodobnych komórek NK (KIR) z występowaniem i przebiegiem klinicznym zesztywniającego zapalenia stawów kręgosłupa."

Podobne prezentacje


Reklamy Google