Pobieranie prezentacji. Proszę czekać

Pobieranie prezentacji. Proszę czekać

PODSTAWY BIOCHEMII DLA OCHRONY ŚRODOWISKA Nukleotydy i kwasy nukleinowe.

Podobne prezentacje


Prezentacja na temat: "PODSTAWY BIOCHEMII DLA OCHRONY ŚRODOWISKA Nukleotydy i kwasy nukleinowe."— Zapis prezentacji:

1 PODSTAWY BIOCHEMII DLA OCHRONY ŚRODOWISKA Nukleotydy i kwasy nukleinowe

2 OH H O H H H HOCH 2 H OH H O H H H HOCH 2 ryboza 2-deoksyryboza N N PIRYMIDYNA cytozyna tymina uracyl N N N N PURYNA adenina guanina O N zasada cukier CH 2 P O O-O- O-O- reszta kwasu ortofosforowego Nukleotydy

3 O N CH 2 P O O-O- O-O- nukleotyd O N CH 2 OH nukleozyd CH 2 P O O-O- O-O- monofoforan nukleozydu CH 2 P O O O-O- P O O-O- O-O- difoforan nukleozydu CH 2 P O O O-O- P O O-O- O P O O-O- O-O- trifoforan nukleozydu Nukleotydy wiązanie N-glikozydowe wiązanie estrowe

4 koniec 5 łańcucha koniec 3 łańcucha O cukier fosforan N zasada N O cukier O fosforan N zasada Fragment łańcucha kwasu nukleinowego wiązanie fosfodiestrowe wiązanie fosfodiestrowe OH

5 Kwasy nukleinowe DNA kwas rybonukleinowy bierze udział w rozkodowywaniu informacji zawartej w DNA koduje informację o budowie i działaniu całego organizmu kwas deoksyrybonukleinowy RNA

6 CH 2 P O O-O- O-O- monofoforan nukleozydu CH 2 P O O O-O- P O O-O- O P O O-O- O-O- trifoforan nukleozydu DNA dATP, dGTP, dCTP, dTTP RNA ATP, GTP, CTP, UTP

7 Podwójna helisa DNA G C A T komplementarne parowanie zasad

8 5 GGTACCAATTCAAAGCTTATG 3 3 CCATGGTTAAGTTTCGAATAC 5 Enzymy restrykcyjne Kpn I GGTAC C C CATGG 5 GGTAC 3 3 C 5 5CAATTCAAAGCTTATG 3 3 CATGGTTAAGTTTCGAATAC 5 Hind III A AGCTT TTCGA A 5 GGTACCAATTCAA 3 3 CCATGGTTAAGTTTCGA 5 5AGCTTATG 3 3ATAC 5 Alu I AG CT TC GA 5 CTTATG 3 3 GAATAC 5 5 GGTACCAATTCAAAG 3 3 CCATGGTTAAGTTTC 5

9 5 GGTACCAATTCAA |||||||||||||||||||| 3 CCATGGTTAAGTTTCGA AGCTTATG 3 | ATAC 5 5 GGTACCAATTCAA |||||||||||||||||||| 3 CCATGGTTAAGTTTCGA AGCTTATG 3 | ATAC 5 5 GGTACCAATTCAA |||||||||||||||||||| 3 CCATGGTTAAGTTTCGA AGCTTATG 3 | ATAC 5 Hind III A AGCTT TTCGA A Hind III 5 GGTACCAATTCAA 3 ||||||||||||| 3 CCATGGTTAAGTTTCGA 5 5AGCTTATG 3 ||| 3ATAC 5 5 GGTACCAATTCAA 3 ||||||||||||| 3 CCATGGTTAAGTTTCGA 5 5AGCTTATG 3 ||| 3ATAC 5 ligaza

10 wektor trawienie enzymem restrykcyjnym Klonowanie DNA DNA zawierający wstawkę, którą chcemy przeklonować trawienie enzymem restrykcyjnym wstawka ligacja wektora ze wstawką plazmid ze wstawką gotowy do wprowadzenia do bakterii

11 mieszanina jednoniciowych cząsteczek DNA jednoniciowa wyznakowana sonda komplementarna do cząsteczki A hybrydyzacja w warunkach ostrych hybrydyzacja w warunkach łagodnych tylko cząsteczka A tworzy stabilną dwuniciową cząsteczkę cząsteczki A, C i E tworzą stabilne dwuniciowe cząsteczki Hybrydyzacja

12 denaturacja DNA w celu uzyskania jednoniciowych cząsteczek inkubacja błony z jednoniciową wyznakowaną radioaktywnie sondą DNA

13 Sekwencjonowanie DNA denaturacja dwuniciowy DNA GCATATGTCAGTCCAG CGTATACAGTCAGGTC GCAT CGTATACAGTCAGGTC jednoniciowy DNA (matryca do sekwencjonowania) GCATATGTCAGTCCAG CGTATACAGTCAGGTC GCAT 5 3 przyłączenie znakowanego startera

14 Sekwencjonowanie DNA GCAT CGTATACAGTCAGGTC dATP, dTTP, dCTP, dGTP + ddATPddGTP ddCTP ddTTP polimeraza DNA GCAT A ATGTCA ATGTCAGTCCA GCAT ATAT ATGT ATGTCAGT GCAT ATGTC ATGTCAGTC ATGTCAGTCC GCAT ATG ATGTCAG ATGTCAGTCCG elektroforeza w żelu poliakrylamidowym

15 Sekwencjonowanie DNA ddATP ddTTP ddCTP ddGTP A T C G GACCTGACTGTAGACCTGACTGTA 5 3

16 bufor Reakcja PCR mieszanina reakcyjna dNTP starter1 starter2 polimeraza Taq dwuniciowa matryca DNA sekwencja docelowa

17 Cykl syntezy DNA w reakcji PCR etap 1 - denaturacja matrycy etap 2 - przyłączenie starterów etap 3 - wydłużanie starterów

18 CYKL 1 denaturacja 94 C jednoniciowa matryca DNA

19 CYKL 1 przyłączenie startera do matrycy C starter 1 starter 2

20 CYKL 1 wydłużanie startera 72 C starter 1 starter 2 powstają cząsteczki dłuższe od sekwencji docelowej

21 CYKL 2 denaturacja matrycy 94 C matryca DNA, który powstał w cyklu 1

22 CYKL 2 przyłączenie startera do matrycy C

23 CYKL 2 wydłużanie starterów 72 C powstają cząsteczki dłuższe od sekwencji docelowej powstają cząsteczki o długości sekwencji docelowej

24 Profil termiczny reakcji PCR cykl podstawowy cykle dodatkowe

25 plazmid pUC18/cDNAPPRas2 ze wstawką 0,8 kp mieszanina A: startery A1 i A2 A1 A2 B2 B1 0,6 kb 0,35 kb Część praktyczna mieszanina B: startery B1 i B2

26 1 - wzorce wielkości 2, 3, 4 - produkty reakcji A, w której jako matrycy użyto lizatu bakterii) 5 - kontrola pozytywna, czyli produkty reakcji A, w której jako matrycy użyto czystego plazmidu 6 - kontrola negatywna, czyli produkty reakcji A, do której nie dodano żadnej matrycy 7 - produkty reakcji B, w której jako matrycy użyto lizatu bakterii) 8 - kontrola pozytywna, czyli produkty reakcji B, w której jako matrycy użyto czystego plazmidu 9 - kontrola negatywna, czyli produkty reakcji B, do której nie dodano żadnej matrycy 10 - wzorce wielkości ,35 kb 1,08 kb 0,87 kb 0,6 kb 0,28 kb 0,23 kb 0,31kb 0,6 kb 0,35 kb 0,19 kb AB


Pobierz ppt "PODSTAWY BIOCHEMII DLA OCHRONY ŚRODOWISKA Nukleotydy i kwasy nukleinowe."

Podobne prezentacje


Reklamy Google