Pobieranie prezentacji. Proszę czekać

Pobieranie prezentacji. Proszę czekać

Wykład 6 3. Kwasy nukleinowe - budowa i funkcje 3.1. Zasady nukleinowe, nukleozydy, nukleotydy 3.2. Budowa i funkcje DNA i RNA

Podobne prezentacje


Prezentacja na temat: "Wykład 6 3. Kwasy nukleinowe - budowa i funkcje 3.1. Zasady nukleinowe, nukleozydy, nukleotydy 3.2. Budowa i funkcje DNA i RNA"— Zapis prezentacji:

1 Wykład 6 3. Kwasy nukleinowe - budowa i funkcje 3.1. Zasady nukleinowe, nukleozydy, nukleotydy 3.2. Budowa i funkcje DNA i RNA

2 Informacja o budowie białek oraz instrukcja o ich syntezie (jakie białko, kiedy, gdzie) jest przechowywana i uruchomiana w cząsteczkach dużych związków, nie przypominających budową białek. Związki te nazywają się kwasami nukleinowymi (nukleus – jądro), występującymi głównie w jądrach komórek. Związki te również są długimi polimerami składającymi się z zaledwie 4 monomerów (jednostek).

3 Informacja o budowie białek (i całego organizmu) jest przechowywana w cząsteczce kwasu deoksyrybonukleinowego (DNA), który jest instrukcją (zapisem) o całym organizmie. Instukcja syntezy białek jest zapisana w cząsteczkach kwasu rybonukleinowego (RNA). Gdy w organizmie potrzebne jest dane białko (do wzrostu organizmu) to wtedy jest syntezowany RNA na podstawie instrukcji zapisanej w DNA. Proces ten nazywa się transkrypcją

4 Nośnikiem informacji genetycznej są zasady nukleinowe zawarte w cząsteczkach DNA (kwasu dezoksyrybonukleinowego, DeoxyriboNucleicAcid). Reszty 2 -deoksyrybozy i reszty fosforanowe pełnią rolę strukturalną. DNA składa się z dwóch helikalnych nici polimeru, nawiniętych na siebie. Rzuty przestrzenne tych polimer ó w są przedstawione na następnych przezroczach.

5

6

7

8 NUKLEOZYDY – połączenia zasad z cukrem: Tutaj – nukleozydy występujące w RNA; cukrem jest ryboza. W DNA jej miejsce zajmuje deoksyryboza, a zamiast urydyny występuje tymidyna

9 NUKLEOTYDY i DEOKSYNUKLEOTYDY (na przykładzie nukleotydów adeninowych)

10 Fragment łańcucha cząsteczki RNA – pojedyncza nić. Łańcuch główny stanowią: grupa fosforanowa i dwa atomy węgla rybozy. Zasady nukleinowe: adenina, guanina, cytozyna i uracyl.

11 Fragment łańcucha cząsteczki DNA – pojedyncza nić – jedna z dwóch nici (przeciwbieżnych), nawiniętych na siebie. Łańcuch główny stanowią: grupa fosforanowa i dwa atomy węgla deoksyrybozy. Zasady nukleinowe: adenina, guanina, cytozyna i tymina.

12 Dwie nici DNA są połączone wiązaniami wodorowymi pomiędzy zasadami tych dwóch przeciwbieżnychnici. Dobre dopasowanie strukturalne zachodzi pomiędzy adeniną i tyminą oraz Dwie nici DNA są połączone wiązaniami wodorowymi pomiędzy zasadami tych dwóch przeciwbieżnych nici. Dobre dopasowanie strukturalne zachodzi pomiędzy adeniną i tyminą oraz pomiędzy guaniną i cytozyną. Na rysunku poniżej zaznaczone są wiązania wodorowe pomiędzy tymi zasadami. Łańcuszkiem zaznaczono łańcuchy główne dwóch nici.

13 Dwie nici DNA mają określoną kolejność (sekwencję) zasad. Sekwencje te są w dwóch niciach KOMPLEMENTARNE, tzn. tam, gdzie w jednej nici jest A, tam w drugiej jest T, a tam, gdzie w jednej nici jest G, to w drugiej jest C i na odwrót. Przykład sekwencji dwóch nici DNA: ATGGCCATCGTAAATTGCGGATTACGGC TACCGGTAGCATTTAACGCCTAATGCCG

14 Przekazanie informacji o strukturze białka od instrukcji (DNA) do syntezowanego białka jest procesem dwuetapowym. W pierwszym etapie na DNA jest syntezowany RNA. Proces ten nazywa się transkrypcją. Ten RNA nazywa się messengerRNA ( w skrócie mRNA) – w polskim języku przyjęto termin informacyjny RNA (ale skrót jest ten sam – mRNA). Następnie na tej makrocząsteczce, której struktura jest odwzorowaniem sekwencji w DNA, na którym została zsyntezowana, odbywa się synteza białka, którego struktura jest zakodowana w tym mRNA. Ten proces nosi nazwę translacji. PRZEPŁYW INFORMACJI GENETYCZNEJ

15 Wykład 7 3. Kwasy nukleinowe - budowa i funkcje 3.3. Kod genetyczny

16 Dwie nici DNA mają określoną kolejność (sekwencję) zasad. Sekwencje te są w dwóch niciach KOMPLEMENTARNE, tzn. tam, gdzie w jednej nici jest A, tam w drugiej jest T, a tam, gdzie w jednej nici jest G, to w drugiej jest C i na odwrót. Przykład sekwencji dwóch nici DNA: ATGGCCATCGTAAATTGCGGATTACGGC TACCGGTAGCATTTAACGCCTAATGCCG Ten kod jest kodem trójkowym, tzn w trzech kolejnych znaczkach zapisana jest informacja o tym, jaki aminokwas białka ma być w danym miejscu sekwencji polipeptydu. Ta trójka nazywa się kodonem. Każdy aminokwas ma swój kodon.

17

18

19

20

21 3.4. Replikacja Gdy z jednej komórki powstaje następna – przez podział, wówczas w jądrze nowej komórki jest DNA z komórki macierzystej. Jest on taki sam, jak w komórce macierzystej, bo powstaje przez rozszczepienie DNA na dwie nici i dobudowanie drugiej, komplementarnej nici. Proces ten nazywa się replikacją. Chemicznie jest dość skomplikowany, ale efektem jest powstanie wiernej kopii.

22

23 Do powstania kopii DNA potrzebne są: Nukleotydy, ściślej 2-deoksynukleotydy: dATP, dTTP, dGTP, dCTP, Enzym Polimeraza DNA (białko katalityczne) Jony Mg(II) i Ca(II) Oryginalna cząsteczka DNA, która działa w tym procesie jak matryca, na której syntezowane są dwie następne nici DNA.

24 3.5. Transkrypcja Cząsteczka DNA jest bardzo długa – zawiera pełną informację o strukturze białek. Kawałek DNA, przechowujący informację o strukturze białka nazywa się genem. Ten gen może ulec przeczytaniu a jego sekwencja jest przetworzona w nową makrocząsteczkę – informacyjny RNA – mRNA. Ten proces nazywa się transkrypcją.

25 Do powstania mRNA potrzebne są: Nukleotydy: ATP, UTP, GTP, CTP, Enzym Polimeraza RNA (białko katalityczne) Jony Mg(II) i Ca(II) Oryginalna cząsteczka DNA, która działa w tym procesie jak matryca, na której syntezowane jest mRNA.

26

27 3.6. Translacja Cząsteczka mRNA jest polinukleotydem – kwasem nukleinowym. Ten kwas nukleinowy jest na tyle długi, że zawiera pełną informację o strukturze pojedynczego białka. Jest to matryca (informacja), na której sekwencja polinukleotydowa jest przetworzona w nową makrocząsteczkę – białko. Ten proces nazywa się translacją.

28 W procesie translacji syntezowany jest łańcuch białka. Bierze w nim udział: informacyjny RNA (mRNA) – stanowi on matrycę, na której syntezowany jest łańcuch aminokwasy (wszystkie 20) przywiązane każdy do swojego nośnika, którym jest cząsteczka tRNA – transportującego RNA zespół enzymów, katalizujących reakcję tworzenia wiązania peptydowego

29 Transferowe (transportujące) RNA to są małe polinukleotydy składające się z pojedynczej nici, tworzącej kształt trójlistnej koniczynki. W głównej pętli znajdują się trzy zasady stanowiące antykodon, których sekwencja jest komplementarna do trójki zasad w kodonie. Ten kodon koduje rodzaj aminokwasu, który ma być przyczepiony do rosnącego łańcucha polipeptydu. Do tRNA z tym antykodonem związany jest aminokwas, który ma być wbudowany. Każdy aminokwas ma swój tRNA. Tak więc istnieje 20 różnych cząsteczek tRNA – tyle, ile jest aminokwasów

30 Proces, w którym sekwencja kodonów mRNA jest tłumaczona na sekwencję aminokwasów w łańcuchu polipeptydowym, jest skomplikowany i składa się z bardzo wielu powtarzających się kroków. Przeprowadzają go struktury cytoplazmatyczne widoczne pod mikroskopem elektronowym jako drobne obiekty. Są to rybosomy, a każdy z nich składa się z ponad pięćdziesięciu różnych białek i trzech lub czterech różnych rodzajów cząsteczek rRNA. Rybosomy wraz z tRNA tworzą maszynerię, która zamienia sekwencje nukleotydów mRNA na sekwencje aminokwasowe białek. Potrzeba do tego także różnorodnych enzymów i innych białek. Zauważmy, że w mRNA mogą wystąpić trzy różne serie trójek nukleotydowych, tak zwane ramki odczytu, w zależności od tego, który triplet zostanie wybrany jako pierwszy kodon. W tym przykładzie, tak jak w większości przypadków, dwie ramki (oznaczone jako B i C) są przerwane kodonami stop i nie mogą ulegać translacji. Tylko ramka A jest otwarta od początku do końca.

31

32

33 W jaki sposób wybierana jest właściwa ramka? Najpierw rybosom i specjalny tRNA niosący cząsteczkę metioniny, którego antykodon może komplementarnie łączyć się z AUG, przyłącza się do mRNA w początkowej pozycji AUG. Są dwa tRNA, które mogą łączyć się z AUG: jeden rozpoczyna wszystkie łańcuchy białkowe od metioniny, drugi zaś służy do wprowadzania metioniny w odpowiedzi na kodony AUG pojawiające się wewnątrz ramki, podczas gdy mRNA ulega translacji.

34

35 Ten specjalny, inicjatorowy tRNA, niosąc cząsteczkę metioniny, przyłącza się razem z rybosomem do kodonu AUG w miejscu startu translacji. Następny aminokwas łańcucha polipeptydowego jest dostarczany do miejsca translacyjnego rybosomu przez tRNA, którego antykodon pasuje do drugiego kodonu mRNA. Pierwsze wiązanie peptydowe powstaje zatem między metioniną a następnym w kolejności aminokwasem: rozpoczyna się synteza łańcucha polipeptydowego. Podczas tłumaczenia każdego kodonu do wydłużającego się łańcucha polipeptydowego dodawany jest jeden aminokwas. Proces ten powtarza się aż do momentu, gdy wszystkie kodony sekwencji kodującej ulegają translacji. Gotowy łańcuch polipeptydowy uwalniany jest z chwilą, gdy aparat translacyjny dotrze do sygnału końca translacji, czyli do jednego z trzech kodonów stop (UAA, UAG lub UGA).

36

37 Są dwie ważne reguły dotyczące kierunku translacji: po pierwsze translacja postępuje od 5' do 3' końca mRNA, po drugie białko rośnie od końca aminowego do karboksylowego. Warto pamiętać, że kierunek ważny jest również przy czytaniu zdań. W różnych językach tekst pisze się w różnych kierunkach. Genetycy przyjęli konwencję zgodną z językami europejskimi. Początek zdania – 5' koniec mRNA i aminowy koniec polipeptydu – zapisuje się z lewej strony. Zakończenie – 3' koniec mRNA i karboksylowy koniec polipeptydu – są wtedy z prawej strony. Zatem zgodnie z taką konwencją, mRNA jest czytany od lewej ku prawej.


Pobierz ppt "Wykład 6 3. Kwasy nukleinowe - budowa i funkcje 3.1. Zasady nukleinowe, nukleozydy, nukleotydy 3.2. Budowa i funkcje DNA i RNA"

Podobne prezentacje


Reklamy Google