Pobieranie prezentacji. Proszę czekać

Pobieranie prezentacji. Proszę czekać

Współdziałanie szlaków sygnałowych zależnych od czynników transkrypcyjnych HSF1 i NFκB Patryk Janus Opiekun pracy: Prof. Dr hab. Piotr Widłak.

Podobne prezentacje


Prezentacja na temat: "Współdziałanie szlaków sygnałowych zależnych od czynników transkrypcyjnych HSF1 i NFκB Patryk Janus Opiekun pracy: Prof. Dr hab. Piotr Widłak."— Zapis prezentacji:

1 Współdziałanie szlaków sygnałowych zależnych od czynników transkrypcyjnych HSF1 i NFκB Patryk Janus Opiekun pracy: Prof. Dr hab. Piotr Widłak

2 Przebieg pracy: I.Identyfikacja genów zależnych od NFκB, których ekspresja ulega zmianie w obecności aktywnej formy HSF1: 1.Całogenomowe profilowanie ekspresyjne w komórkach U2-OS w warunkach hipertermii i/lub stymulacji cytokiną TNFα: a)przeprowadzenie eksperymentu – stymulacja komórek HS i/lub TNFα, b)analiza mikromacierzowa – Human Genome U133 Plus 2.0 Array (Affymetrix), c)normalizacja i analiza otrzymanych danych mikromacierzowych. 2.Analiza funkcjonalna: a)wybór genów up- i down-regulowanych w różnych wariantach traktowania HS i/lub cytokiną TNFα, b)wykorzystanie internetowych baz danych umożliwiających klasyfikację wybranych genów do określonych ścieżek sygnałowych i procesów biologicznych – Gene Ontology, KEEG Pathway, PANTHER. II.Identyfikacja genów zależnych od NFκB, z których promotorami wiąże się HSF1: 1.ChIP - sequencing 2.ChIP – real-time PCR  kinetyka wiązania się aktywnego czynnika HSF1 do promotorów wybranych genów zależnych od NFκB: a)bioinformatyczna analiza promotorów genów zależnych od NFκB, których ekspresja ulega zmianie w obecności aktywnego HSF1 (wg danych mikromacierzowych, wg danych ChIP-seq) b)przeprowadzenie eksperymentu – stymulacja komórek HS i immunoprecypitacja chromatyny z przeciwciałem anty-HSF1 c)przeprowadzenie reakcji real-time PCR dla wybranych genów

3 1. Całogenomowe profilowanie ekspresyjne (…) a) przeprowadzenie eksperymentu U2OS WTU2OS TG -1,5h -0,5h 0h 1,5h TNFα HS -1,5h -0,5h 0h 1,5h TNFα WT K WT TNF WT HS/TNF WT HS TG K TG TNF b) analiza mikromacierzowa TNFα 10 ng/ml HS 43°C c) normalizacja i analiza otrzymanych danych mikromacierzowych

4 1. Całogenomowe profilowanie ekspresyjne (…) NFκB consensusHSF1 consensus Liczba genów posiadająca w obszarze promotorowym motyw dla czynnika NFκB lub/i czynnika HSF1 (wg bazy GO) genów poddanych analizie metodą mikromacierzy

5 1. Całogenomowe profilowanie ekspresyjne (…) Wpływ szoku termicznego (HS) lub obecności aktywnego czynnika HSF1 (aHSF1) na zmianę profilu ekspresji genów potencjalnie zależnych od NFκB lub HSF1

6 1. Całogenomowe profilowanie ekspresyjne (…) Zmiana profilu ekspresji genów aktywowanych cytokiną TNFα (TNF) w komórkach typu „dzikiego” (WT) stymulowanych HS lub w komórkach z ekspresją konstytutywnie aktywnego czynnika HSF1 (TG) (WT HS/TNF vs WT K) (TG TNF vs TG K) 324 geny WT TNF (WT TNF vs WT K) (wzrost lub spadek ekspresji) (WT HS/TNF vs WT HS) (TG TNF vs WT K) 1748 genów (wzrost lub spadek ekspresji) genów (wzrost lub spadek ekspresji) genów (wzrost lub spadek ekspresji) 274 geny (wzrost lub spadek ekspresji)

7 1. Całogenomowe profilowanie ekspresyjne (…) (WT HS/TNF vs WT K) (TG TNF vs TG K) 324 geny WT TNF (WT TNF vs WT K) (wzrost lub spadek ekspresji) (WT HS/TNF vs WT HS) (TG TNF vs WT K) 1748 genów (wzrost lub spadek ekspresji) genów (wzrost lub spadek ekspresji) genów (wzrost lub spadek ekspresji) 274 geny (wzrost lub spadek ekspresji)

8 2. Analiza funkcjonalna 324 geny WT TNF (WT TNF vs WT K) (wzrost lub spadek ekspresji)

9 1. Całogenomowe profilowanie ekspresyjne (…) 324 geny WT TNF (WT TNF vs WT K) (wzrost lub spadek ekspresji) Z motywem dla NFκB 113 Z motywem dla HSF1 29 INNE 182

10 1. Całogenomowe profilowanie ekspresyjne (…) 324 geny WT TNF (WT TNF vs WT K) (wzrost lub spadek ekspresji) Z motywem dla NFκB 113 Z motywem dla HSF1 29 INNE 182

11 Geny z motywem dla NFκB: ADAMTS6 ARAP2 ARL14 ATF3 AZIN1 BCL2A1 BDKRB1 BDNF BIRC2 BIRC3 BTG2 C14orf43 C19orf21 C3orf52 CCL2 CCL20 CCNL1 CD83 CEP135 CHRND CHST3 COL12A1 CYP27B1 CYR61 DCAF12 DNAJC30 DNASE2 DUSP2 EDN1 EGR1 EGR2 EGR4 EHD1 EPB41L2 ETS1 ETS2 FAM179A FAM46C FAM82B FEM1C FOSB FOSL1 FRMD6 GADD45B GEM GJB3 HIST1H1A HMGCS1 HOXA3 IFNGR2 IKBKB IL17RD IL8 INHBA IRF1 IRF2BPL ITPRIPL2 KBTBD2 KCTD11 LAMB3 LIF MAP2K3 MED26 MSX1 NACC2 NFKB1 NFKBIA NFKBIE NR2F2 NR4A1 NR4A2 PCDH7 PMEPA1 PPP1R15A PSG2 PTX3 REL RELB RHOB RPS19BP1 RRAD S1PR1 SAT1 SDC4 SLC12A7 SMAD7 SQSTM1 TBC1D1 TGIF1 TIPARP TMEM126B TMEM170A TNFAIP3 TNFRSF9 TNIP1 TRAF5 TRAK1 TRIM47 UPF2 USP37 USP46 WDR1 WDR24 ZC3H10 ZCCHC9 ZFP36 ZFP90 ZNF133 ZNF140 ZNF398 ZNF441 ZNF805 ZNF827 + aHSF1 GeneSymbolWT TNF vs WT KTG TNF vs TG K ADAMTS61,371,30 ARAP20,701,12 ARL142,902,64 ATF32,191,17 AZIN11,221,12 BCL2A13,244,49 BDKRB12,393,34 BDNF0,640,72 BIRC21,331,38 BIRC37,275,81 BTG21,671,62 C14orf431,571,41 C19orf210,860,98 C3orf521,701,99 CCL28,266,14 CCL2010,246,01 CCNL11,571,10 CD834,734,39 CEP1351,261,22 CHRND1,041,00 CHST30,850,97 COL12A11,191,11 CYP27B12,001,24 CYR611,301,06 DCAF120,951,00 DNAJC300,901,06 DNASE21,181,00 DUSP22,101,25 EDN11,801,55 EGR12,230,91 EGR23,390,96 EGR42,370,91 EHD11,301,44 EPB41L21,251,11 ETS11,431,49 ETS21,851,97 FAM179A0,921,00 FAM46C1,511,38 GeneSymbolWT TNF vs WT KTG TNF vs TG K FAM82B0,880,91 FEM1C1,451,08 FOSB4,051,61 FOSL11,551,22 FRMD61,091,20 GADD45B1,521,03 GEM1,681,56 GJB30,740,89 HIST1H1A0,740,94 HMGCS11,301,25 HOXA30,800,93 IFNGR21,321,20 IKBKB1,121,01 IL17RD0,831,00 IL88,814,18 INHBA1,631,74 IRF13,372,39 IRF2BPL0,810,91 ITPRIPL20,840,99 KBTBD21,251,07 KCTD111,461,50 LAMB31,611,58 LIF1,441,49 MAP2K31,121,16 MED261,191,04 MSX11,321,16 NACC20,790,89 NFKB13,213,11 NFKBIA2,871,38 NFKBIE2,261,90 NR2F20,800,82 NR4A11,550,94 NR4A21,640,91 PCDH70,791,01 PMEPA10,810,95 PPP1R15A1,561,30 PSG20,991,00 PTX310,1011,06 GeneSymbolWT TNF vs WT KTG TNF vs TG K REL2,722,42 RELB3,442,78 RHOB1,371,01 RPS19BP10,900,88 RRAD1,431,23 S1PR10,911,02 SAT11,441,12 SDC41,461,27 SLC12A72,031,69 SMAD71,331,19 SQSTM11,291,12 TBC1D10,941,01 TGIF10,841,02 TIPARP1,610,96 TMEM126B0,930,95 TMEM170A1,160,88 TNFAIP39,123,40 TNFRSF91,782,46 TNIP11,211,25 TRAF50,750,93 TRAK10,890,99 TRIM471,341,43 UPF20,920,95 USP370,850,95 USP460,900,99 WDR11,141,08 WDR240,971,00 ZC3H100,780,90 ZCCHC90,880,92 ZFP361,851,11 ZFP900,871,01 ZNF1330,720,85 ZNF1401,231,12 ZNF3980,971,00 ZNF4410,971,00 ZNF8051,200,98 ZNF8270,750,90

12 Geny ze zmienionym poziomem ekspresji pod wpływem tgHSF1 >= 20%: GeneSymbolWT TNF vs WT KTG TNF vs TG KRóżnica w % EGR23,390,96 71,7 TNFAIP39,123,40 62,7 EGR42,370,91 61,4 FOSB4,051,61 60,2 EGR12,230,91 59,1 IL88,814,18 52,6 NFKBIA2,871,38 52,1 ATF32,191,17 46,8 NR4A21,640,91 44,4 CCL2010,246,01 41,3 DUSP22,101,25 40,3 TIPARP1,610,96 40,2 ZFP361,851,11 40,1 NR4A11,550,94 39,0 CYP27B12,001,24 37,9 ARAP20,701,12 37,3 GADD45B1,521,03 32,4 CCNL11,571,10 29,6 IRF13,372,39 29,2 BDKRB12,393,34 28,5 BCL2A13,244,49 27,9 TNFRSF91,782,46 27,6 RHOB1,371,01 26,2 CCL28,266,14 25,7 FEM1C1,451,08 25,1 TMEM170A1,160,88 24,2 SAT11,441,12 22,1 HIST1H1A0,740,94 21,6 PCDH70,791,01 21,4 FOSL11,551,22 21,2 BIRC37,275,81 20,0

13 II. Identyfikacja potencjalnych sekwencji HSE 1. Bioinformatyczna analiza promotorów genów zależnych od NFκB ze zmienionym profilem ekspresji pod wpływem tgHSF1 >=20% tctcccgcaaccccaggagcaagcctactaaagggtttctctgcatcgttgttattttactttctggctctggaatctggacaaagcaaattggaatctggcatgagtttgctactcttttaatagccctgatacatcttggagtgccccatttagtcgggcatttttacaggtctattttaaaga aagttgtttctttgttggatttttaatcaaaacaaaaaagttcaaatgcttaatagtagggaccatggtacatgtttgtattcaactctcacattctccatccccacacccctccacctccagcacagtatcttgctcagtaaaccctttggagtttttacttgtccgcacttctttcttttctcacct cttcttgtctccaggaaggatactgtggggctagcttctcttatgacagcgcctattagtatgctggctttgtgccagcctggctattccatccacagtctaggtctggagagcccaagaactcaaattctccctttacagtgggcagggggcgtgtccatgacagtcccttcctccttgcctgt agaaagccctgacctcagctttgctctcctcagaaatggcaaagaaaggagatgaaattggcggaggcggcctgattcttccctagtgggctgagtcaggctcccaatcctcaaagaagtgttcacttttcagacctgggttttcctgagggcacgatgtagcgaccactgtgcgctgtact tggattcagaagacccagctgcaagtttggacacgaccacttaccagctacgtgactttaggcaagccactttagctttctgagcttatccacagggtggctggcttgaaagggtgcgccttgattctgttccattatctgcactacccatatttaagggttggtacttcaagagacactcaa aaaaacaaaggttacgagagttatctactgacttgtttcagcggaggttcaataaaggcctcccaggactggccccaggcattccctggcctccccgcagctgccgcccgtccccgcccccactccattccctgcgcaccccaggct(…….4210………) ATG EGR2 ttctcaaaagaagcccaattatttcaagtactgattccagggagatatttcccacggattccctgtgtgttgctgggatcaacatccttagagcgaaagccatttgtatgaaggcagaaaaaatgttctgcagaagcatctcataccctgtgggtgagggaggagtgagcaggaattggcc ctacttttctggaagacaatttgccagttgtctatcaaaattttacatatactttggcacacaattacactcgttggaatttatctcacagacacattcacatttatatagtcaaggatgttgactccaacaacattggtataagtaaaaagttggaaactgcctacatgctcatggatagggg acaaatcgactaactcaaggtcctcccttacaatggagtactatacagccttgaaaaagaatgacaagatctttatgtcaggacatggcacaatctctaagttatttcaagtgaaaaaataataataataataatattgcagaacaatgtgtatggttggatatacataaaattcttctga aagaatacccaagaaacttaaatgtggctacctcaggagctaggaatgaaggtaggtggagaggagggacttttacttttcaatttagaatataccctgttgtgctagttgactttcctcctactgttaacaagtattacagtcctttttaatttaaattatttttcctagcacaaatttaaaaa aaaaaaacttaaaatggaaaaacacacaggcgtgagcaaaagaaatgaatggcaataatctctgtggtttactgagtgcgcctggacatttatgtgctctcagtttctctccacaggaaatgcacaggtgagaaactgacgttaagggggactgagtgtcaagctagttagtggcaga gggcagattcaaacccaacacggtcctcccctgctgcccctcggcctctgcctccaggtgggaagcgcatctaccggacggtcggcccggtgaggcgcagcgccccagactggcgcatccgcggccccagcgctccacgcctggggagcgcgcgcgcacgcagcggcgcgagcctggc ggcggcggcgacaacaacaacgtcacagctcgagctttccttttcgggagtccccggcacacatcctgtgtccatgtttgggcatttacgtcacggcggcagggccggggcctcccaaaATG EGR4 cgggcaatcagcttccccacttcggtcccccaaaggtgggctctttgccggcggggactagggaacagcctttcggttccgggggagcacaggggaccccaggcaccagcagccccatcccaccgacaggtggcagaggcaaggcagctcactgctatacagtgtcccaagaaccaa gtggccgtgacttcctatcctcaatttcccagcgacacccggaaagacaccgtgccatagatcgaggcccggggtcaaggccccgcctctcctgggcggcccctgcccaggcgggcccagccgctcctcccccgcactcccggttcgctctcacggtccctgaggtgggcgggcgggccct ggatgacagcgatagaaccccggcccgactcgccctcgcccccgctctgggtctgggcttccccagcctagttcacgcctaggagccgcctgagcagccgcgcgcccagcgccacacgccacgagccctccccgcctgggcgtccccggatcccgcgagcgctcgggctcccggcttgg aaccagggaggagggagggagcgagggagcaaccagctgcgacccggaaatgccatataaggagcaggaaggatcccccgccggaacaacccttatttgggcagcaccttatttggagtggcccgatatggcccggccgcttccggctctgggaggagggaagaaggcggaggga ggggcaacgcgggaactccggagctgcgcgggtcccggaggccccggcggcggctagagctctaggcttccccgaagcctgggcgcctgggatgcgggcgcgggcgcgggccctagggtgcaggatggaggtgccgggcgctgtcggatggggggcttcacgtcactccgggtcctc ccggccggtcctgccatattagggcttcctgcttcccatatatggccatgtacgtcacgacggaggcggacccgtgccgttccagacccttcaaatagaggcggatccggggagtcgcgagagatcccagcgcgcagaacttggggagccgccgccgccatccgccgccgcagccagct tccgccgccgcaggaccggcccctgccccagcctccgcagccgcggcgcgtccacgcccgcccgcgcccagggcgagtcggggtcgccgcctgcacgcttctcagtgttccccgcgccccgcatgtaacccggccaggcccccgcaactgtgtcccctgcagctccagccccgggctgca cccccccgccccgacaccagctctccagcctgctcgtccaggATGgccgcggc… EGR1 Konsensus dla HSF1

14 II. Identyfikacja potencjalnych sekwencji HSE 2. Przeprowadzenie eksperymentu 3. Analiza


Pobierz ppt "Współdziałanie szlaków sygnałowych zależnych od czynników transkrypcyjnych HSF1 i NFκB Patryk Janus Opiekun pracy: Prof. Dr hab. Piotr Widłak."

Podobne prezentacje


Reklamy Google