Pobieranie prezentacji. Proszę czekać

Pobieranie prezentacji. Proszę czekać

Mikrobiologia Przemysłowa Mikroorganizmy stosowane w procesach przemysłowych.

Podobne prezentacje


Prezentacja na temat: "Mikrobiologia Przemysłowa Mikroorganizmy stosowane w procesach przemysłowych."— Zapis prezentacji:

1 Mikrobiologia Przemysłowa Mikroorganizmy stosowane w procesach przemysłowych

2 Drzewo życia – czyli filogenetyczny podział organizmów planety Ziemia FILOGENETYKA - dyscyplina biologii zajmująca się odtwarzaniem dróg rozwoju rodowego poszczególnych grup organizmów, zarówno żyjących współcześnie, jak i w epokach minionych

3 Drzewo życia – czyli filogenetyczny podział organizmów planety Ziemia Drzewo filogenetyczne zbudowane jest w oparciu o taksony Takson - grupa organizmów na tyle do siebie podobnych, że można ją wyróżnić i zaklasyfikować do jakiejś kategorii systematycznej np. klasy, rodziny, gatunku Podstawową jednostką klasyfikacji biologicznej jest gatunek System klasyfikacji musi być oparty na cechach występujących we wszystkich żywych organizmach

4 Drzewo życia – czyli filogenetyczny podział organizmów planety Ziemia Molekularna miara stopnia pokrewieństwa – sekwencja DNA wspólnych genów – genów kodujących rybosomalny RNA (Carl Woese) dla organizmów prokariotycznych – geny kodujące 16S rRNA dla organizmów eukariotycznych – geny kodujące 18S rRNA

5 Molekularna miara stopnia pokrewieństwa Porównanie sekwencji genów rRNA z różnych organizmów Organizm I ACTGCATTACGCCTTAAGAGGCTCT Organizm II ACTGCATTAGGCCTTAAGAGGCTCT Organizm III ACTGCATAATGCACAATGAGGCTCT Sekwencja zmienna Sekwencja zakonserwowana Organizm I Organizm II Organizm III

6 Molekularna miara stopnia pokrewieństwa - trzy domeny organizmów

7 Pyrococcus woesei izolowany z morskiej solfatary (Porto di Levante, wyspa Volcano, Włochy) Domena: Archaea Grupa: Euryarchaeota Klasa: Thermococci Rząd: Thermococcales Rodzina: Thermococcaceae Rodzaj: Pyrococcus Gatunek: Pyrococcus woesei Beztlenowiec Optimum temperatury °C Optimum pH - 6,0 Optimum NaCl - 30% Produkty metabolizmu - H 2, H 2 S (w obecności S 0 ) Ziarniak 0,8 - 2,0 μm Urzęsienie lofotrichalne Klasyfikacja taksonomiczna mikroorganizmów - archeony

8 Deinococcus geothermalis izolowany z gorących źródeł (Sao Pedro, Portugalia) Domena: Bacteria Grupa: Deinococcus-Thermus Klasa: Deinococci Rząd: Deinococcales Rodzina: Deinococcaceae Rodzaj: Deinococcus Gatunek: Deinococcus geothermalis Tlenowiec Optimum temperatury °C Optimum pH - 7,2 Podwyższona oporność na promieniowanie jonizujące i UV Podwyższona oporność na warunki ograniczonej wilgotności Ziarniak Gram+ Brak urzęsienia Klasyfikacja taksonomiczna mikroorganizmów - bakterie

9 Saccharomyces cerevisiae izolowany ze skórek winogron Domena: Eukarya Królestwo: Fungi Gromada: Ascomycota Podgromada: Saccharomycotina Klasa: Saccharomycetes Rząd: Saccharomycetales Rodzina: Saccharomycetaceae Rodzaj: Saccharomyces Gatunek: Saccharomyces cerevisiae Metabolizm tlenowy i beztlenowy Optimum temperatury °C Optimum pH - 6,5 Klasyfikacja taksonomiczna mikroorganizmów - eukariota komórki kuliste lub owalne μm średnicy

10 Bakterie Mikroorganizmy jednokomórkowe Otoczone sztywną ścianą komórkową (za wyjątkiem mykoplazm) Brak jądra komórkowego, DNA zlokalizowane w cytoplazmie, 1 – 2 chromosomy, mogą zawierać DNA plazmidowe Szybki wzrost i metabolizm Rozmnażanie przez podział komórki Zdolność do horyzontalnego transferu genów – nabywania DNA od innych mikroorganizmów i włączania go do własnego genomu Wielkość: długość 1-5 μm; średnica 1-2 μm Kształt: kulisty lub owalny, cylindryczny, spiralny

11 Podstawowe kształty i ugrupowania komórek bakterii ziarniaki dwoinki paciorkowce gronkowce czworaczki pakietowce pałeczki śrubowce przecinkowce

12 Laseczki - Bacillus

13 Pałeczki - bacterium Escherichia coli

14 Maczugowce - Corynebacterium

15 Śrubowce - Spirillum i Krętki - Spirochaetea

16 Przecinkowce - Vibrio

17 Ziarniaki - Coccus

18 Zdolność do ruchu – rzęski występowanie i sposób ułożenia rzęsek jest cechą o znaczeniu taksonomicznym Taksja – ukierunkowany ruch jako odpowiedź na bodźce zewnętrzne: chemo-, foto-, aero-, magneto-, termotaksja monotrichalne lofotrichalne amfitrichalne peritrichalne

19 Formy przetrwalne bakterii - endospory Clostridium tetani Bacillus thuringiensis

20 Otoczki bakteryjne Neisseria meningitidis dwoinka G- wytwarza polisacharydową otoczkę optymalna temp. wzrostu 37°C wzrost na pożywkach wzbogaconych z dodatkiem krwi Postacie kliniczne zakażeń N. meningitidis posocznica z zapaleniem opon mózgowo-rdzeniowych – 60% zakażeń inwazyjnych, śmiertelność 11% posocznica – 20% zakażeń inwazyjnych, śmiertelność 20 – 53% zapalenie opon mózgowo-rdzeniowych – 20% zakażeń inwazyjnych, śmiertelność 1,2% zapalenie spojówek, osierdzia, stawów, płuc substancja czynna szczepionki – wyizolowane i oczyszczone polisacharydy otoczki N. meningitidis

21 Obserwacja komórek bakterii Obserwacje mikroskopowe żywych bakterii nie pozwalają na rozpoznanie kształtów i szczegółów struktur komórkowych. Kształt bakterii obserwuje się zwykle po ich wybarwieniu. Do celów diagnostycznych stosuje się barwienie różnicujące, metodę Grama, która jest podstawą podziału bakterii na dwie grupy o odmiennych cechach fizjologicznych i biochemicznych.

22 Hans Christian Gram ( – ) Duński farmakolog i lekarz. W roku 1884 opublikował autorską metodę barwienia bakterii. Dokonał przełomowego odkrycia przyczyniającego się do rozwoju mikrobiologii

23 Budowa ściany komórkowej bakterii G- i G+ G+ G-

24 Mechanizm barwienia metodą Grama 1. Komórki bakteryjne (G+ i G-) barwią się fioletem krystalicznym. 2. Dodanie płynu Lugola powoduje, że fiolet reaguje z jodem, w wyniku czego tworzą się stosunkowo duże kompleksy złożone z barwnika i jodu. 3. Płukanie alkoholem powoduje, że w komórkach G+ następuje zmniejszenie pustej przestrzeni w wielowarstwowych ścianach komórkowych, mających wygląd wielu (ok. 50) nałożonych na siebie siatek mureiny. W rezultacie kompleksy fioletu krystalicznego z jodem nie mogą ulec wypłukaniu, co w przypadku 1-2 warstw u bakterii G- nie jest przeszkodą i alkohol świetnie wypłukuje barwnik. 4. Po zakończeniu płukania komórki G+ są fioletowe, zaś G- - bezbarwne. 5. Dodatkowy barwnik np. fuksyna dobarwi komórki G- na kolor czerwony, nie zmieniając barwy komórek G+.

25 Thermus Thermophilus - barwienie metodą Grama i błękitem metylenowym Deinococcus geothermalis – barwienie metodą Grama i błękitem metylenowym

26 Promieniowce - Actinomycetales Bakterie, których komórki, w postaci cienkich nitek, tworzą rozgałęzienia na wzór strzępków grzybni; promieniowce tworzą też zarodniki (spory, konidia). O przynależności do bakterii decydują: brak jądra komórkowego, podobny skład chemiczny ściany komórkowej, wrażliwość na fagi. Naturalne środowisko: gleba, rozkładająca się masa roślinna, wilgotne stogi siana, torfowiska, sterty odpadów organicznych, rzadziej zbiorniki wodne.

27 Promieniowce - Actinomycetales Przeważnie tlenowce Są chemoorganotrofami Optymalna temperatura wzrostu °C (zakres 15-37°C) Optymalne pH bliskie 7 (zakres 5,0-9,0) Barwią się Gram dodatnio Tworzą 3 rodzaje pseudogrzybni (powietrzną, substratową i wgłębną) Rozmnażają się przez podział nitek pseudogrzybni oraz zarodniki

28 Promieniowce - Actinomycetales Najważniejsze rodzaje promieniowców Actinoplanes Geodermatophilus Micromonospora Nocardia Streptomyces Klasyfikacja na podstawie cech morfologicznych, fizjologicznych i pigmentacji

29 Promieniowce - Actinomycetales

30 Morfologia strzępek i układów sporonosnych promieniowców

31 Przemysłowe zastosowanie bakterii właściwych i promieniowców Promieniowce produkcja antybiotyków (np. aktynomycyna, amfoterycyna B, kanamycyna, neomycyna, nystatyna, tetracyklina) produkcja leków steroidowych - biokonwersja (kortyzon, hydrokortyzon) produkcja witamin (witamina B 12 ) produkcja enzymów (proteazy, izomeraza glukozowa)

32 Przemysłowe zastosowanie bakterii właściwych i promieniowców Bakterie właściwe produkcja kwasu octowego (Acetobacter sp.) produkcja kwasu mlekowego (Lactobacillus delbrueckii) produkcja fermentowanych produktów mlecznych (Lactococcus lactis, Streptococcus thermophilus, Lactobacillus acidophilus) produkcja nizyny (Lactococcus lactis) produkcja kwasu glutaminowego (Corynebacterium glutamicum) produkcja antybiotyków (Bacillus brevis – gramicydyna S) produkcja etanolu (Zymomonas mobilis) źródło genów kodujących enzymy nośnik obcych genów


Pobierz ppt "Mikrobiologia Przemysłowa Mikroorganizmy stosowane w procesach przemysłowych."

Podobne prezentacje


Reklamy Google