Pobieranie prezentacji. Proszę czekać

Pobieranie prezentacji. Proszę czekać

Paweł Golik Instytut Genetyki i Biotechnologii Uniwersytet Warszawski

Podobne prezentacje


Prezentacja na temat: "Paweł Golik Instytut Genetyki i Biotechnologii Uniwersytet Warszawski"— Zapis prezentacji:

1 Paweł Golik Instytut Genetyki i Biotechnologii Uniwersytet Warszawski

2 Początki Charles Darwin

3 Biologia ewolucyjna? Nothing in Biology Makes Sense Except in the Light of Evolution Theodosius Dobzhansky ( )

4 Biologia ewolucyjna? Więc ja już 40 przeszło lat mówię prozą, nie mając o tym najmniejszego pojęcia! Molière Każdy biolog korzysta z teorii ewolucji, nawet jeżeli nie zdaje sobie z tego sprawy!

5 Pierwsza synteza Darwinizm + genetyka klasyczna + genetyka populacji Syntetyczna teoria ewolucji Mutacje jako podstawa zmienności ewolucyjnej W populacjach naturalnych występują rozmaite allele wielu genów, nowe powstają w wyniku mutacji Ewolucja jako zmiany częstości alleli w populacji

6 Pierwsza synteza 4 główne siły ewolucji Mutacje Przepływ genów Dobór naturalny Dryf genetyczny

7 Druga synteza Darwinizm + genetyka molekularna ewolucja molekularna Molekularne mechanizmy ewolucji Jak zachodzą zmiany sekwencji DNA (i białek), jak ewoluują genomy Jak działa dobór naturalny na poziomie sekwencji Genetyczna kontrola rozwoju w ewolucji (evo-devo) Ewolucja molekularna jako narzędzie do poznawania funkcji genów i genomów

8 Podobieństwo i homologia Homologia: podobieństwo wynikające ze wspólnego pochodzenia ewolucyjnego – cecha odziedziczona od wspólnego przodka

9 Homologia czy homplazja

10 Podobieństwo i homologia sekwencji Przy dostatecznie dużym podobieństwie można założyć, że sekwencje są homologiczne Podobne struktury przestrzenne i/lub funkcje mogą być determinowane przez różne sekwencje Liczba możliwych sekwencji aminokwasowych o nietrywialnej długości jest gigantyczna Na poziomie sekwencji praktycznie nie stwierdza się konwergencji, homoplazje są przypadkowe

11 Paralogi i ortologi Paralogi – geny homologiczne w tym samym genomie, powstałe w wyniku duplikacji genu - np. α-globina i β- globina człowieka Ortologi – geny homologiczne powstałe w wyniku specjacji, pochodzące od genu u wspólnego przodka – np. α-globina człowieka i α-globina myszy

12 Ewolucja globin

13 Nowe geny powstają dzięki duplikacji DNA Duplikacje wewnątrz genu Tasowanie eksonów Duplikacje całych genów Duplikacje fragmentów i całych chromosomów (aneuploidia) Duplikacje genomu (poliploidia)

14 Ewolucja genów opsyn

15 Ewolucja widzenia kolorów

16 Homologia genów jako źródło informacji Duplikacje paralogiczne są źródłem nowych genów i nowych funkcji, ale często działających na podobnej zasadzie Np. poszukiwanie nowych enzymów o funkcji zbliżonej do już znanych Geny ortologiczne z reguły (choć nie zawsze) zachowują funkcję organizmy modelowe – wnioskowanie o funkcji genów na podstawie badań nad innymi organizmami np myszy, a nawet drożdże jako modele do badania chorób człowieka

17 Białka składają się z domen

18 Tasowanie eksonów

19 Wspólne motywy w różnych genach Możemy stawiać hipotezy dotyczące funkcji nieznanych białek na podstawie motywów znajdowanych w sekwencji. Podstawa większości współczesnych badań biochemicznych!!

20 Genomika Genomika jest dziedziną zajmującą się badaniem całych genomów (kompletu informacji genetycznej) różnych organizmów Techniki biologii molekularnej + robotyka + informatyka Sekwencjonowanie i charakteryzowanie genomów Badanie funkcji zawartych w nich genów

21 Craig Venter Francis Collins (NIH)

22

23 TCACAATTTAGACATCTAGTCTTCCACTTAAGCATATTTAGATTGTTTCCAGTTTTCAGCTTTTATGACTAAATCTTCTAAAATTGTTTTTCCCTAAATGTATATTTTA ATTTGTCTCAGGAGTAGAATTTCTGAGTCATAAAGCGGTCATATGTATAAATTTTAGGTGCCTCATAGCTCTTCAAATAGTCATCCCATTTTATACATCCAGGCAATAT ATGAGAGTTCTTGGTGCTCCACATCTTAGCTAGGATTTGATGTCAACCAGTCTCTTTAATTTAGATATTCTAGTACATACAAAATAATACCTCAGTGTAACCTCTGTTT GTATTTCCCTTGATTAACTGATGCTGAGCACATCTTCATGTGCTTATTGACCATTAATTAGTCTTATTTGTTAAATGTCTCAAATATTTTATACAGTTTTACATTGTGT TATTCATTTTTTAAAAAATTCATTTTAGGTTATATGTATGTGTGTGTCAAAGTGTGTGTACATCTATTTGATATATGTATGTCTATATATTCTGGATACCATCTCTGTT TCATGCATTGCATATATATTTGCCTATTTAGTGGTTTATCTTTTCATTTTCTTTTGGTATCTTTTCATTAGAAATGTTATTTATTTTGAGTAAGTAACATTTAATATAT TCTGTAACATTTAATGAATCATTTTATGTTATGTTTAGTATTAAATTTCTGAAAACATTCTATGTATTCTACTAGAATTGTCATAATTTTATCTTTTATATACATTGAT ATTTTTATGTCAAATATGTAGGTATGTGATATTATGCACATGGTTTTAATTCAGTTAATTGTTCTTCCAGATGTTTGTACCATTCCAACATCATTTAAATCATTAAATG AAAAGCCTTTCCTTACTAGCTAGCCAGCTTTGAAAATCCATTCATAGGGTTTGTGTTAATATATTTTTGTTCTTTTTTTTCCTTTCTACTGATCTCTTTATATTAATAC CTACTGTGGCTTTATATGAAGTCATGGAATAATACGTAGTAAGCCCTCTAACACTGTTCTGTTACTGTTGTTATTGTTTTCTCAGGGTACTTTGAAATATTCGAGATTT TATTATTTTTTAGTAGCCTAGATTTCAAGATTGTTTTGACGATCAATTTTTGAATCAATTGTCAATATTTTTAGTAATAAAATGATGATTTTTGATTGGAAATACATTA AATCTATAAGCCAAATTGGAGATTATTGATATATTAACAAAAATGAGTTTTCCAGTCCATGAATGTATGCACATTATAAAATTCATTCTTAAGTATGTCATTTTTTAAG TTTTAGTTTCAGCAGTATATGTTTGTTACATAGGTAAACTCCTGTCATGGGGGTTAGTTGTACAGGTTATTTTATCATCCAGGCATAAAGCCCAGTACCCAGTAGTTAT CTTTTCTGCTCCTCTCCCTCCTGTCACCCTCCACTCTCAAGTAGACCCCAGTTTCTGTTGTTCTCTTCTTTGCATTAATGACTTCTCATCATTTAGATTGCACTTGTAA GTGAGAACAGGACGTATGTGGTTTTCTACTCCTGTGTTAGTTTGCTAAGGATAACCACCTCCATCTCCATCCATGTTCCCACAAAAGACATGATCTCCTTTTTTATGGC TGCATATTATTCCATGGTATATATGTACCACATTTTCTTTATCCAATCTGTCATTGATGGACATTTAGGTTGTTTCCACATCATTGCCGTTGTAAATACTGCTGCAGTG AATATTCGTGTGTATGTCTTTATGGTAGAATGATTTATATTCCTCTGGGTATATTTCCAAGTAATGGGATGGTTGGGTCAAATGGTAATTCTGCTTTTAGCTTTTTGAG GAATTGCCATATTGCCTTTCACAACGGTTGAACTAATTTATACTCCCAAGAGTGTATAAGTTGTTCCTTTTTCTCTGCAACCTCGACATCACCTGTTATTTATGACTTT TATATAATAGCCATTCTGCTGGTCTGAGATGGTATCTCATTATGATTTTGATTTGCATTTCTCTAATGCTCAGTGATATTGAGCTTGGCTGCATATATGTCTTCTTTTA AAAATATCTGTTCATGTCCTTTGCCTAATTTATAACGGGGTTGTTTGTTTTTCTCTTGTAAATTTGTTTAAGTTCCTTATAGATTCTAGGTATTAAACCTTTTTTCAGA GGCGTGGCTTGCAAATATTTTCTCCCATTCTATAGGTTGTCTGTTTATTCTGTTGATAGTTTCCCTTGCTGTGCAGAAGCTCTTAACTTTAATTAGATCCGACTTGTCA ATTTTTGCTTTGGTCGCAATTGCTTTTGATGTTATTGTCGTGAAATCTTTGCTAGTTCTTAGGTCCAGGATGATATTGCCCAAGTTGTCTTCCAGGGCTTTTATAATTT TGGATTTTACATTTAAGTCTTAATATATTTATTAAATTTGTTAGGGTTTCAGGATACAAGGACAATATAGCAGCAAACAATGTAAAAGTAAAATCTGAAAAATAATAGA AAACAGTTTAATTGAACACTTTACCATTATGTAATGCCCTTCTTTGTCTTTCCTGATCTTTGTTGGTTTGAAGTTCAAAAAAGACAAACTTAATGGTACAATAGGTATT GTAGATTTCAGGACTTTCTGTATAAAATATTTTGTATATATGAATAGATCATTTTTTATTTCCAGTCTTTAAACATTTTCTTAACATTTTCTTCTATTGCTTCACTTCA CTCGCTAGGACCATCAGGACAGTGTTGAACAGAAATTGTCAGACTGATCATCACAACTTTTTCTAGATTTTAGAAGGAAATTTTTCTTTATTTCAACATAAAGCAGCAT GTTAATGCCAAGTTTTAATATGTGTTATCAGATTGAAATTTTTTTGTATATTTCTACATTACCAAGAATTTTTAGCAAGAGTTTTTGTTGAGTTTTAATTTAAAAATCA TTTGTTAATTTCATCTGATTTTTTTATTTCTCTTTTTACCTTAAGAGATTAAACTGACTACAGATTGAATATAAACAAACAAACAAACAAACAAAAACTCTAAAATGCT GTGGATCAACACCACTTAGTAATTTGTATACTTGGATTCAATTTGCTGAAATTTTGTTAGACATTTTTGCGTCGATATTTATGAGGGATGTTGATCTGTAAAAGTATTA AAATGCCTTTGACAGATAGTGTCACCATATAAAAAACTTTGAACAAAATCAGATTATATCACTGTGGATATTTCTATTTTGAACTAACTTAGATGATAATTTTAATCTA TATCCTAGATGAACT Co to znaczy? Mały fragment chromosomu 21

24 Co to znaczy? Bez teorii ewolucji nie mielibyśmy możliwości poznania odpowiedzi na to pytanie Odszukujemy geny podobne do genów już zbadanych Możemy badać geny przez odwrotną genetykę – tworzenie mutantów u organizmów modelowych Porównując genomy możemy wnioskować o biologii organizmu

25 Genomika porównawcza bakterii sposobem poznania ich fizjologii Bakterie mają genomy podobnej wielkości, mieszczące genów Około połowy genomu tworzą rodziny podobnych genów powstałych przez powielenie (duplikację) – tzw. rodziny paralogów To, które geny są powielone świadczy o kierunku specjalizacji ewolucyjnej bakterii

26 Genomika porównawcza bakterii E. coli – heterotrof pasożytniczy – powielone geny kodujące białka rozkładające różne związki organiczne Methanococcus janaschii – chemoautotrof – powielone geny kodujące enzymy szlaków biosyntetycznych Pseudomonas aeruginosa – groźny patogen oporny na wiele leków i szybko dostosowujący się do zmian środowiska– powielone geny kodujące białka usuwające antybiotyki, rozkładające substancje organiczne, umożliwiające zagnieżdżanie się w powierzchniach.

27 Metagenomika Analiza sekwencji całości DNA wyizolowanego ze zbiorowiska organizmów

28 Metagenomika Pozwala na badanie bioróżnorodności odkrywanie nowych gatunków badania ekologiczne (interakcje organizmów i środowiska) wyszukiwanie nowych, przydatnych enzymów, białek o właściwościach leczniczych itp. A to wszystko dzięki teorii ewolucji identyfikacja sekwencji w metagenomach na podstawie podobieństwa do sekwencji genomów znanych gatunków badanie pokrewieństwa

29 Co tempo zmian sekwencji mówi o funkcji?

30 Mutacje Szkodliwe – są szybko eliminowane przez dobór negatywny (oczyszczający) Neutralne – nie wpływają na funkcję produktu, nie podlegają selekcji Korzystne – są szybko utrwalane w populacji przez dodatni dobór naturalny

31 Teoria neutralna (Kimury) Większość obserwowanych różnic w sekwencjach, zarówno wewnątrzpopulacyjnych, jak i międzygatunkowych to mutacje neutralne, utrwalane przez dryf genetyczny Mutacje niekorzystne są eliminowane i nie obserwujemy ich (modyfikacja – mutacje prawie neutralne nie są w pełni eliminowane i mogą się w pewnych warunkach utrwalać) Mutacje korzystne są bardzo rzadkie, mają znaczenie ale w analizach ilościowych są pomijalne

32 Tempo zmian białka jest kształtowane przez dobór naturalny Tzw. sekwencje zachowawcze (konserwowane) – zmieniają się powoli, zmiany eliminowane przez dobór – sekwencje o kluczowej i niezmiennej funkcji Sekwencje o mniej znaczącej lub zmieniającej się w toku ewolucji funkcji zmieniają się szybciej

33 Tempo zmian

34 Tempo zmian jest różne w różnych obszarach sekwencji Obszary silnie zachowawcze odpowiadają najważniejszym dla funkcji miejscom w białku.

35 Mutacja czy polimorfizm? Wykrywamy różnicę w DNA u chorego na jakąś chorobę Może to być Mutacja powodująca chorobę Niezwiązana z chorobą cecha zmienna w populacji Jak to sprawdzić?

36 Mutacja czy polimorfizm?

37 Ewolucjonizm w poszukiwaniu tajemnicy człowieczeństwa

38 Różnice ewolucyjne Nowe geny Utrata genów Zmiany liczby kopii (paralogów) genów Zmiany w genach (mutacje) Zmiany w ekspresji

39 Różnice na poziomie białek Przeciętne białko ludzkie różni się 2 aminokwasami od szympansiego odpowiednika 29% białek jest identycznych

40 Różnice w genach Około genów – znaczące odchylenia od hipotezy zegara molekularnego (sugeruje odstępstwa od neutralności) Około 200 obszarów o przyspieszonej ewolucji w linii człowieka (HAR – Human Accelerated Regions) – przeważnie obszary niekodujące, ale w pobliżu sekwencji regulatorowych Geny o Ka/Ks (ω) >1 – układ odpornościowy, spermatogeneza, apoptoza

41 Jak szukać śladów działania doboru Większość sekwencji genów zmienia się jednostajnie, w tempie wyznaczanym przez eliminację mutacji niekorzystnych – zegar molekularny Odstępstwa od jednostajnego tempa w określonej gałęzi – dobór specyficzny dla tej gałęzi Równomierne tempo zmian Przyspieszone zmianySpowolnione zmiany

42 Zmiany genów – gen mowy Rzadka choroba dziedziczna objawiająca się zaburzeniami mowy, niezdolnością do tworzenia struktur składniowych i gramatycznych. Gen FOXP2

43 FOXP2 – szybka ewolucja Enard et al. (2002) Nature 418,

44 MYH16 Jedna z form łańcucha ciężkiego miozyny Mutacja ok. 2,5 mln lat temu – związek z ewolucją kształtu czaszki – osłabienie mięśni szczęki, zmniejszenie twarzoczaszki, wzrost mózgoczaszki

45 Gen mikrocefaliny Chory 13 latZdrowy 11 lat Szybka ewolucja genu u człowieka Mikrocefalia Kouprina et al., PLoS Biology, 2004, 5:E126

46 Inne geny o przyspieszonej ewolucji ASPM homologia do białka Drosophila odpowiadającego za wykształcanie wrzeciona podziałowego mutacje u człowieka powodują mikrocefalię MGC8902 zawiera wiele powtórzeń domeny DUF1220, liczba powtórzeń wzrosła w linii człowieka, ekspresja w korze mózgowej, nieznana funkcja Prodynorfina (prekursor przekaźników w układzie nerwowym)

47 Podsumowanie Nie ma jednego, czy kilku genów człowieczeństwa Za różnice między ludźmi a innymi gatunkami odpowiada kumulacja wielu, pozornie niewielkich, różnic Niewielkie zmiany sekwencji mogą pociągać znaczne zmiany fenotypowe Istotne są też różnice na poziomie regulacji – trudniejsze do zbadania

48 Triumf Darwina Ewolucja cech specyficznie ludzkich była związana z szeregiem cząstkowych zmian dotykających różnych genów Koncepcja Darwina wyrażona językiem genomiki porównawczej! różnica między człowiekiem a innymi zwierzętami ma charakter ilościowy, a nie jakościowy

49 Organizmy modelowe Les éléments vitaux étant de nature semblable dans tous les êtres vivants, ils sont soumis aux mêmes lois organiques... Podstawowe jednostki życia, mając u wszystkich żyjących istot podobną naturę, rządzone są tymi samymi prawami organicznymi... Claude BERNARD ( )

50 Modele w naukach przyrodniczych Modele analogii przyczynowej CAM Przyczyny i skutki w układzie modelowym i docelowym są takie same. Nie mogą zaistnieć jakiekolwiek istotne przyczynowo braki analogii między modelem a modelowanym zjawiskiem. * Modele analogii hipotetycznej (HAM) Doprowadzenie do sformułowania hipotez, które mogą mieć ogólne znaczenie tak dla układu modelowego, jak i docelowego. Nie dostarczają danych mających bezpośrednie znaczenie dla medycyny człowieka, jednak polepszając nasze rozumienie zjawisk biologicznych mogą one sugerować możliwe mechanizmy fizjologiczne u człowieka.

51 Saccharomyces cerevisiae

52 Drożdże jako organizm modelowy Łatwa hodowla i testy fenotypowe Fizjologia typowa dla mikroorganizmów Bezpieczne i nieszkodliwe dla środowiska Dobrze poznana genetyka klasyczna (analiza tetrad, mapy) Łatwe manipulacje genetyczne (odwrotna genetyka, plazmidy) Znana od 1996 sekwencja genomu

53 Genomy S. cerevisiaeH. sapiens ~1,2 x 10 7 bp~3 x 10 9 bp ~6500 genów~ genów ~1800 genów wykazuje homologie z genami H. sapiens (30%) ~ 4000 genów wykazuje homologie z genami S. cerevisiae (13%) Wiele podstawowych funkcji komórki jest zachowanych. Niekiedy możliwa wymienność białek drożdżowych i ludzkich (np. Ras, Oxa1)

54 Przykładowe drożdżowe modele chorób Progerie Wernera i Blooma Choroby związane z defektami naprawy DNA (HNPCC, ataksja-telangiektazja) Ataksja Friedreicha Zaburzenia komunikacji jądrowo - mitochondrialnej (PEO) Choroby wywołane mutacjami w mtDNA (NARP) Poszukiwanie leków za pomocą drożdży

55 Zespół Wernera Normalny rozwój w dzieciństwie. Przedwczesne starzenie rozpoczyna się wraz z wiekiem dojrzewania. Niski wzrost, owrzodzenia, zwapnienia. Pacjenci dożywają średnio 47 lat. Przyczyną śmierci z reguły choroba nowotworowa, albo schorzenia sercowo- naczyniowe. Przyczyna: mutacje genu WRN kodującego helikazę DNA z rodziny RecQ

56 SGS1 – model drożdżowy Gen SGS1 jest drożdżowym homologiem genów WRN i BLM. Fenotyp delecji SGS1: zwiększona rekombinacja mitotyczna (zwłaszcza subtelomerowa) zaburzenia segregacji chromosomów zaburzenia mejozy Białko Sgs1p jest zaangażowane w hamowanie nieuprawnionej rekombinacji i utrzymywanie stabilności genomu. Ludzkie geny BLM i WRN częściowo komplementują fenotyp delecji SGS1

57 HNPCC (zespół Lyncha) HNPCC - dziedziczny rak jelita grubego niezwiązany z polipowatością Około 5% wszystkich raków jelita grubego Mutacje w genach kodujących białka zaangażowane w naprawę niedopasowanych nukleotydów (mismatch repair) Podwyższona częstość mutacji, zwłaszcza niestabilność traktów z powtórzeniami Najczęściej mutacje genów hMSH2 i hMLH1

58 Drożdżowy model HNPCC W mutantach drożdżowych wzrost spontanicznej mutagenezy Alfred & Borts (2007) Biochem Soc Trans, 35: Dla dokładniejszego zbadania efektu konkretnych mutacji ludzkich stworzono hybrydowe geny, w których fragmenty genu S. cerevisiae zastępuje się pochodzącymi z genów człowieka tak, by zachować funkcję w drożdżach (tzw. humanizowanie drożdży).

59 Ataksja Friedreicha Choroba układu nerwowego i mięśni zaburzenia czucia obniżone napięcie mięśniowe kardiomiopatia, deformacje kręgosłupa i stóp Autosomalna recesywna; 1/ Mutacja dynamiczna w genie frataksyny Akumulacja żelaza w mitochondriach: Zaburzenia systemów naprawczych mtDNA Zaburzenia w oddychaniu Stres oksydacyjny Bramwell: Atlas of Clinical Medicine

60 YFH1 – drożdżowy homolog frataksyny Białko wiążące żelazo Mitochondrialny magazyn żelaza Detoksykacja nadmiaru żelaza Włączanie żelaza do centrów Fe-S

61 YFH1 – drożdżowy homolog frataksyny Fenotyp delecji: defekt oddychania mitochondrialnego zwiększona wrażliwość na stres oksydacyjny akumulacja żelaza w mitochondriach: 10-krotnie większe stężenie od szczepu dzikiego zależna od żelaza oksydacyjna degradacja centrów Fe-S Ludzki gen kompensuje delecję genu drożdżowego Cavadini i wsp., (2000), Hum Mol Genet, 9:

62 Choroby wywołane mutacjami w mtDNA Np. NARP – Neurogenic Ataxia Retinitis Pigmentosa Mutacja w genie ATP6 W komórkach 70-90% zmutowanego DNA Obniżona aktywność syntezy ATP Mechanizm nieznany

63 Drożdże w poszukiwaniu nowych leków Systemy homologiczne Interaktory białek drożdżowych homologicznych do białek ludzkich Białka docelowe dla znanych związków drobnocząsteczkowych Systemy heterologiczne Interaktory białkowe – system dwuhybrydowy Ekspresja w drożdżach białka (np. ludzkiego) i poszukiwanie ligandów np. choroby degeneracyjne związane z agregacją białek: choroba Alzheimera, Huntingtona itp. poszukiwanie ligandów toksyn bakteryjnych

64 Organizmy modelowe Podstawowe jednostki życia, mając u wszystkich żyjących istot podobną naturę, rządzone są tymi samymi prawami organicznymi... Claude BERNARD ( ) Ale dlaczego? Ponieważ wszystkie żyjące gatunki łączy wspólne pochodzenie. Charles DARWIN ( )

65 Medycyna ewolucyjna

66 Dlaczego chorujemy? Przyczyny bezpośrednie Bo zainfekował nas wirus, bo złamaliśmy nogę itp. Przyczyny pierwotne Wyścig ewolucyjny pasożytów i gospodarzy Dlaczego nasze ciało jest zbudowane tak a nie inaczej – ewolucyjne kompromisy Historia ewolucji naszych przodków a przystosowanie do współczesnego środowiska Nowotwór jako proces ewolucyjny Dlaczego się starzejemy?

67 Wyścigi z patogenami Sekwencje genów kodujących białka układu odpornościowego należą do najszybciej zmieniających się w ewolucji Sekwencje białek wirusów, bakterii itp. też szybko się zmieniają Szukając tych obszarów sekwencji, które zmieniają się najszybciej możemy wskazać, które białka powinny być celem dla leków, który szczep wirusa będzie najgroźniejszy itp. Bakterie i wirusy szybko uodparniają się na leki

68 Ciało człowieka - ekosystem Ciało człowieka zawiera około (biliard, 1000 bilionów) komórek Helicobacter pylori - bakterie w żołądku Demodex folliculorum roztocza Ale tylko 5-10% to nasze, ludzkie komórki!

69 Doug Green -- SMC Bio March 2004 FYS 163: Science as a Way of Knowing Wyścig z patogenami - oporność Staphylococcus aureus 1928: odkrycie penicyliny (Alexander Flemming) 1943: masowa produkcja i stosowanie penicyliny 1947: odkryte pierwsze oporne szczepy S. aureus 1997:S. aureus nabywa oporność na wankomycynę Dziś: 50% infekcji S. aureus oporne na penicylinę, metycylinę, erytromycynę i tetracyklinę Problem: oporność nie tylko na pojedyncze, ale i na wiele antybiotyków

70 Oporność na penicylinę Pneumococcus u dzieci (Islandia)

71 Wyścigi z patogenami Terapia wieloelementowa (HAART, np. AIDS) Pojedyncze leki przeciwwirusowe nie są skuteczne – bardzo szybko ewoluują oporne wirusy Sposób – stosowanie kilku różnych leków działających na różne procesy cyklu życiowego wirusa – nie daje szansy na wyewoluowanie oporności

72 Każdego roku powstaje wiele (ok ) różnych wariantów wirusa. Trzeba przewidzieć, który z nich będzie zagrożeniem w następnym sezonie, żeby przygotować szczepionkę Analiza ewolucyjna wskazała 18 kodonów w genie kodującym hemaglutyninę wirusa, które podlegają silnemu działaniu doboru dodatniego Ten ze szczepów, u którego jest najwięcej zmian w tych kodonach najprawdopodobniej będzie źródłem następnej infekcji Trafność: 9 na11 = 0,818 Szczepionki przeciw grypie

73 Historia gatunku a choroby Każdy gatunek to efekt kompromisu ewolucyjnego (przystosowanie kontra ograniczenia) Człowiek nie jest naprawdę dobrze przystosowany do chodzenia na dwóch nogach problemy z kręgosłupem i stawami kształt miednicy, ciężki poród oko (nerwy nad siatkówką) – plamka ślepa, odklejanie siatkówki – problem wszystkich kręgowców

74 Historia gatunku a choroby Środowisko człowieka współczesnego nie jest tym, do którego przystosował się w ewolucji Dostępność pokarmów bogatych w tłuszcz i węglowodany Nasi przodkowie (jak inne zwierzęta) nie znali sytości Przewlekły stres Mechanizm stresu powstał w ewolucji jako przystosowanie (mechanizm walki lub ucieczki, mobilizacja w sytuacji krytycznej) Pomaga poradzić sobe z niebezpieczeństwem gdy trwa krótko, ale jest zabójczy gdy trwa dłużej

75 Mitochondria Liczba mitochondriów w komórce ludzkiej wynosi przeważnie kilkaset do kilku tysięcy Każde mitochondrium zawiera od 1 do około 10 cząsteczek mitochondrialnego DNA (mtDNA) Komórki są w stanie żyć bez mtDNA, nie zaś bez mitochondriów Mitochondria u człowieka dziedziczą się od matki

76 Dobór naturalny a migracje

77 Ewolucyjna medycyna mitochondrialna Niektóre polimorfizmy mtDNA mają znaczenie selekcyjne Warianty zaadoptowane do zimnego klimatu: słabsze sprzężenie OXPHOS z wytwarzaniem ATP, część energii gradientu protonowego rozpraszana w postaci ciepła Warianty zaadoptowane do ciepłego klimatu: wydajne sprzężenie OXPHOS z wytwarzaniem ATP, optymalne wykorzystanie energii z pokarmu

78 Adaptacje mtDNA – konsekwencje Ciepły klimatZimny klimat Silne sprzężenie OXPHOS z wytwarzaniem ATP Słabsze sprzężenie OXPHOS z wytwarzaniem ATP Wydajne wykorzystanie kalorii z pokarmu Mniej wydajne wykorzystywanie kalorii z pokarmu, termogeneza W połączeniu z wysokokaloryczną dietą zwiększone wytwarzanie ROS Mniejsze wytwarzanie ROS przy diecie wysokokalorycznej Krótszy czas życiaDługowieczność Podatność na choroby degeneracyjne (np. AD), cukrzycę. Mniejsza zapadalność na choroby degeneracyjne (AD, PD, cukrzyca). Mniejsza zapadalność na choroby związane z defektami OXPHOS (np. LHON). Większa zapadalność na choroby związane z defektami OXPHOS (np. LHON).

79 To nie wszystko Ekologia ewolucyjna (tak naprawdę nie ma innej) Biologia rozwoju Fizjologia Antropologia i archeologia Ochrona środowiska... a nawet psychologia


Pobierz ppt "Paweł Golik Instytut Genetyki i Biotechnologii Uniwersytet Warszawski"

Podobne prezentacje


Reklamy Google