Pobieranie prezentacji. Proszę czekać

Pobieranie prezentacji. Proszę czekać


Podobne prezentacje

Prezentacja na temat: "DIAGNOSTYKA MOLEKULARNA. METODY MOLEKULARNE  PCR  Hybrydyzacja  FISH  Sekwencjonowanie."— Zapis prezentacji:


2 METODY MOLEKULARNE  PCR  Hybrydyzacja  FISH  Sekwencjonowanie

3 ŁAŃCUCHOWA REAKCJA POLIMERAZY Polimerase Chain Reaction (PCR)  Pozwala na powielenie dowolnej sekwencji DNA o długości od kilkuset do kilku tysięcy nukleotydów  Polega na przeprowadzeniu wielu cykli syntezy kwasu nukleinowego z wykorzystaniem starterów flankujących określony odcinek DNA

4 IZOLACJA RNA (wirusy) 1.Przygotoanie próbek krwi, skóry, włosów itd. 2.Dezintegracja komórek – TRIZOL, Chloroform 3.Odwirowanie zanieczyszczeń 4.Zamrożenie RNA (- 80 0 C)

5 MECHANIZM REAKCJI CZYNNIKI:  Jednoniciowa matryca DNA  Startery (primery)  dNTP (trójfosforany deoksynukleotydów)  Polimeraza DNA

6 CYKL PCR 1.Denaturacja DNA (92 - 96 0 C) 2.Przyłączanie starterów do matrycy (37-72 0 C) 3.Polimeryzacja DNA (72 0 C )

7 DENATURACJA (> 90 0 C)

8 PRZYŁĄCZANIE STARTERÓW (37-72 0 C) Sekwencja duplikowana Primer 1 Primer 2 5’ 3’ 5’ 3’ 5’ 3’

9 WYDŁUŻANIE ŁAŃCUCHÓW (72 0 C) Sekwencja duplikowana Primer 1 Primer 2 5’ 3’ 5’ 3’ 5’ 3’ Polimeraza Taq DNA Wolne nukleotydy


11 LICZBA KOPII SEKWENCJI DNA PODCZAS REAKCJI PRC Cykle Liczba łańcuchów DNA 1 2 2 4 3 8 4 16 5 32 6 64 20 1,048,576 30 1,073,741,824



14 METODY DIAGNOSTYCZNE OPARTE NA PCR  PCR  PCR MULTIPLEKSOWY: Równoczesna amplifikacja kilku regionów genomu w jednej probówce stosując różne pary starterów. (Diagnostyka chorób genetycznych, wykrywanie mutacji, wykrywanie czynników zakaźnych)

15  NESTED PCR: Dodanie zestawu nowych (bardziej swoistych) starterów po przeprowadzeniu wstępnej reakcji PCR. (Kontrola swoistości reakcji, stworzenie sondy molekularnej z produktu PCR)  KOMPETYTYWNY PCR: Analiza ilościowa badanego fragmentu genomu.

16  PCR-RFLP Produkt amplifikacji jest poddawany procesowi cięcia enzymami restrykcyjnymi, w wyniku czego otrzymuje się fragmenty DNA różnej długości.  RT-PCR Właściwy PCR jest poprzedzony odwrotną transkrypcją (przepisaniem informacji z RNA na DNA) dzięki enzymowi: odwrotna transkryptaza.

17 ODWROTNA TRANSKRYPCJA (RT-PCR) Mieszanina RT-PCR Wyizolowane RNA Odwrotna transryptaza Stabilizator (DTT) Bufor z jonami akt. Nukleotydy Stała temperatura (37 0 C) w czasie 30 min.

18 Nazwa i pochodzenie enzymu Jon aktywujący Uwagi Tth PolymeraseZ Thermus thermophilus Mn++ Termostabilna, z jonami Mg wykazuje aktywność polimerazy DNA MMuLV RewerseTranskryptaseZ Moloney Murine LeucemiaVirus Mg++ najpowszechniej stosowana odwrotna Transkryptaza AMV ReverseTranskryptaseZ Avian MyeloblastosisVirus Mg++ Coraz powszechniej stosowana odwrotna Transkryptaza Cth Polymerase Klenow FragmentZ Carbohydrothermus hydrogenoformans Mg++ Stosowana w mieszaninie z Taq polimerazą do jednostopniowej reakcji RT-PCR

19  ASYMETRYCZNY PCR: Dodanie pary starterów z których jeden zostaje całkowicie zużyty podczas pierwszych cykli amplifikacji DNA. (Produkt może być sondą molekularną w reakcji hybrydyzacji lub matrycą w reakcji sekwencjonowania.)  AMPLIFIKACJA ALLELOSPECYFICZNA: Ważna jest tu komplementarność nukleotydów przy końcach 3` primerów, ponieważ umożliwia ona elongację DNA przez polimerazę. (Badanie polimorfizmu alleli, punktowych mutacji, powiązań genetycznych, wyjaśnienie działania substancji mutagennych, wykrywanie genów sprzężonych z chorobami, badanie lekooporności mikroorganizmów

20  ELEKTROFOREZA Elektroforeza kwasów nukleinowych obecnie przeprowadzana jest głównie na żelach agarozowym i akryloamidowym oraz w tzw. płynnych (nisko spolimeryzowanych) żelach akryloamidowych w kapilarach. ANALIZA PRODUKTÓW PCR

21  ELEKTROFOREZA AGAROZOWA Produkt PCR pod wpływem napięcia elektrycznego wędruje w żelu agarozowym.

22  ELEKTROFOREZA AKRYLOAMIDOWA Jest powszechnie, chociaż niesłusznie uważana za bardziej precyzyjną od agarozowej oraz (słusznie) za tańszą. Zaletami tego podłoża są niskie koszta oraz możliwość wybarwiania rozdzielonych frakcji DNA poprzez srebrzenie, które daje wyraźne, widoczne gołym okiem i trwałe obrazy.

23 Wybarwianie elektroforetycznie rozdzielonego na żelu DNA może być przeprowadzane za pomocą bromku etydyny lub innego, podobnego barwnika (np. SYBR Gold, który jest o wiele czulszy lecz znacznie droższy), natomiast w przypadku elektroforezy kapilarnej szczególnie popularne jest wielokolorowe barwienie fluorescencyjne, wykorzystujące wzbudzoną laserem fluorescencję wbudowanych w łańcuch DNA fluorochromów.

24 HYBRYDYZACJA Wykorzystuje sondy molekularne (kwas nukleinowy o określonej sekwencji), będące odcinkami komplementarnymi do szukanych fragmentów genomu. Najważniejsze typy to: Southern blotting - badanie DNA Northern blotting – badanie RNA




28 Mikromacierz nylonowa 8 x 12 cm Mikromacierz nylonowa (powiększenie) 4 x 5 mm  

29  HYBRYDYZACJA in situ (FISH) Pozwala zlokalizować sekwencję kwasu nukleinowego w komórce lub odpowiednim rejonie chromosomu. Znakomita większość sond wykorzystywanych w metodzie FISH znakowana jest bezpośrednio fluorochromem. Najczęściej stosowanymi fluorochromami są fluoresceina (FITC), rodamina, czerwień teksańska (Texas Red) i Aqua (DEAC).

30 Obraz chromosomów komórek linii raka prostaty  Metoda M-FISH Hybrydyzacja in situ multipleksowa 

31  SEWENCJONOWANIE: Polega na określeniu sekwencji nukleotydów. Metoda chemiczna – chemiczne rozszczepianie kolejnych nukleotydów badanego fragmentu DNA. Metoda enzymatyczna (Sangera) – synteza komplementarnej nici DNA na matrycy wykorzystująca system znakowania trójfosforanów czterech dideoksynukleotydów fluorochromami w czterech różnych kolorach, są 3 warianty:

32 1. Dye Primer Sequencing- przeprowadza się cztery niezależne reakcje PCR z czterema porcjami primera, każda porcja znakowana jest fluorochromem w innym kolorze. Produkty czterech reakcji miesza się i analizuje wspólnie. 1. Dye Primer Sequencing - przeprowadza się cztery niezależne reakcje PCR z czterema porcjami primera, każda porcja znakowana jest fluorochromem w innym kolorze. Produkty czterech reakcji miesza się i analizuje wspólnie. 2. Cycle Sequencing - startuje się z bardzo małą ilością DNA, przeprowadza reakcję PCR, a po każdej denaturacji termicznej uzyskuje się coraz dłuższy łańcuch zakończony znakowanym nukleotydem. 3. Dye Terminator Sequencing - używa się mieszanki nie znakowanych trójfosforanów nukleotydów i znakowanych trójfosforanów dideoksynukleotydów. Była stosowana przez konkurujące zespoły naukowe które z sukcesem zakończyły sekwencjonowanie genomu człowieka.

33 Starter komplementarny do matrycy DNA 3’ 5’ 3’ GCCTAGGGTTTGCGCTAC Wydłużanie startera przy użyciu polimerazy DNA CGGATCCCAAACGCGATGCAGGCATGCAATGACC Schemat automatycznego sekwencjonowania DNA dATP dGTP dTTP dCTP ddCTP ddTTP ddATP ddGTP Terminatory znakowane fluorescencyjnie ddG GTddC GddT GTCCddG GTCddC GTCCGddT GTCCGTddA GTCCGTACddG GTCCGTAddC GTCCGTACGddT GTCCGTACGTddT GTCCGTACGTTddA GTCCGTACGTTAddC GTCCGTACGTTACddT GTCCGTACGTTACTddG GTCCGTACGTTACTGddG Laser Detektor Rozdział produktów reakcji w automatycznym sekwenatorze

34 =*=-=*=-=*=-=*=-

Pobierz ppt "DIAGNOSTYKA MOLEKULARNA. METODY MOLEKULARNE  PCR  Hybrydyzacja  FISH  Sekwencjonowanie."

Podobne prezentacje

Reklamy Google