Pobieranie prezentacji. Proszę czekać

Pobieranie prezentacji. Proszę czekać

Grzegorz Koczyk (2004) Analogi genów odpornościowych Oryza sativa – ich występowanie i struktura. Everything should be made as simple,

Podobne prezentacje


Prezentacja na temat: "Grzegorz Koczyk (2004) Analogi genów odpornościowych Oryza sativa – ich występowanie i struktura. Everything should be made as simple,"— Zapis prezentacji:

1 Grzegorz Koczyk (2004) Analogi genów odpornościowych Oryza sativa – ich występowanie i struktura. Everything should be made as simple, as possible but not simpler." - Albert Einstein

2 Od sekwencji do funkcji - bioinformatyka {A,C,G,T} n {A,R,N,D,C,Q,E,G,H,I,L,K,M,F,P,S,T,W,Y,V} n/3 Funkcja (np. powielanie informacji genetycznej)

3 Homologia Podobieństwo Pokrewieństwo Homologia (podobieństwo = pokrewieństwo) Homoplazja (podobieństwo pokrewieństwo)

4 Porównywanie sekwencji – czy... ? NIE można bezpośrednio ocenić homologii. Możemy tylko oceniać ją na podstawie podobieństwa.

5 Porównywanie sekwencji – czy... ? Statystyczna istotność (nieprzypadkowość) Biologiczna istotność (homologia) P(S>s) E-value = P(S>s) * n Liczba oczekiwanych false positives przy przeszukiwaniu bazy liczącej n sekwencji

6 Indukowana odpowiedź obronna przeciwko patogenom (reakcja nadwrażliwości) avr R R Specyficzna odporność gen-na-gen Odbiór – geny R muszą umożliwiać specyficzne wykrycie konkretnego sygnału - obecności patogenu. Produkt translacji mRNA genu R odbiera sygnał – obecność produktu genu avr (czynnik awirulencji). Przekaz - geny R muszą umożliwiać wywołanie konkretnej reakcji komórki – przekaz sygnały n.p. przez aktywację kaskady kinaz.

7 Geny odpornościowe - struktura: Błona komórkowa LRR Xa21 LRR Cf9 kinaza Pto kinaza LRR NBS TIR LRR NBS CC CC-NBS-LRRTIR-NBS-LRR SA CC SA-CC

8 Geny odpornościowe – podstawowe domeny: LRR kinase NBS TIR CC Ser/Thr kinase Leucine Rich Repeats Toll / Interleukin Receptor Nucleotide Binding Site Coiled coil / leucine zipper

9 Ewolucja genów odpornościowych: Ewolucja – geny R muszą być zdolne do efektywnej odpowiedzi na zmieniające się czynniki w postaci produktów genów avr. Ich ewolucja powinna więc być szybka, a efektywne warianty upowszechniać się w genomie. Pewne geny R (Pto, RPS2) to zakonserwowane sekwencje starożytnego (w skali wieku genomu) pchodzenia. Studia porównawcze pokazują że ortologi genów R są bardziej zbliżone do siebie nawzajem niż paralogi. ALE:

10 Ewolucja genów R - równowaga: Odmienne warianty genów R obecne w puli to rezerwuar potencjalnej odporności. Zamiast skupiania się na efektywności pojedyńczych genów Polimorfizm na poziomie populacji Gwałtowne zmiany specyficzności genów R nadal mogą zachodzi na drodze rekombinacji międzyallelicznej. Indywidualne geny R są nadal zdolne do szybkiej ewolucji i gwałtownych zmian specyficzności.

11 Poszukiwanie genów odpornościowych in silico (uwagi): Geny znalezione przez nasze poszukiwania należą do tej samej klasy strukturalnej, niekoniecznie funkcjonalnej co prawdziwe geny odpornościowe. Stąd: RGA (resistance gene analogs) Opisy sekwencji w bazach danych są niedokładne. Lepsze kryteria: wysokie podobieństwo do znanych genów R (E-value < 1e-10; unikanie propagowania fałszywych diagnoz) obecność i względne położenie domen charakterystycznych dla genów R (na podstawie przewidywanej sekwencji białkowej)

12 Poszukiwanie genów odpornościowych in silico (model) Baza danych sekwencji ryżu (TIGR) BLASTP na zdefiniowanym zbiorze sekwencji referencyjnych HMM (odciski palców) domen znajdowanych w genach odpornościowych Odpytywanie powstałej struktury danych o RGA (analogi genów odpornościowych) poszczególnych klas strukturalnych. Poszukiwanie nowych wariantów.

13 Narzędzia – BLASTP - wyszukiwanie sekwencji: Możliwości: poszukiwanie podobieństwa pomiędzy sekwencjami w dużych bazach. ocena prawdopodobieństwa przypadkowego wystąpienia dopasowania do zapytania tak dobrego jak znalezione (E- value). Pułapki: wyniki przeszukiwań są tak dobre jak zbiór sekwencji referencyjnych (niewykryte niewielkie homologie, problemy z wszędobylskimi sekwencjami np. kinazami). ocena prawdopodobieństwa bazuje na pewnym modelu tworzenia losowych sekwencji. Ten model nie musi być zawsze prawdziwy. Omijamy tę wadę używając restrykcyjnych E-value (minimalizacja false positives).

14 Narzędzia - HMM - odciski palców domen: Możliwości: poszukiwanie domen w sekwencjach białkowych. Takie odciski palców są dostępne w bazach danych np. Pfam. ocena prawdopodobieństwa przypadkowego wystąpienia dopasowania do odcisku tak dobrego jak znalezione. Pułapki: HMMy są tworzone na bazie zbioru sekwencji zawierających domenę – wyniki przeszukiwań są tak dobre jak początkowy zbiór treningowy (przykład: roślinna domena TIR). ocena prawdopodobieństwa bazuje na pewnym modelu tworzenia losowych sekwencji. Ten model nie musi być prawdziwy. Omijamy tę wadę używając empirycznie wyznaczonych gathering thresholds.

15 Sekwencje referencyjne (przeszukiwanie BLASTP): KlasaGenPatogenŻywicielACC TIR- NBS- LRR RPP5Peronospora parasitica Arabidopsis thaliana AAF NTobacco Mosaic Virus Nicotiana tabacum A54810 L6Melampsora liniLinum usitatissimum T18546 MMelampsora liniLinum usitatissimum AAB CC- NBS- LRR RPS2Pseudomonas syringae p.v. tomato Arabidopsis thaliana NP RPM1Pseudomonas syringae p.v. maculicola Arabidopsis thaliana NP

16 Sekwencje referencyjne (przeszukiwanie BLASTP): KlasaGenPatogenŻywicielACC CC- NBS- LRR I2Fusarium oxysporium t.sp. lycopersicon Lycopersicon esculentum AAD Mla1Erysiphe graminis f.sp. hordei Hordeum vulgare AAG NBS- LRR Pi-taMagnaporthe griseaOryza sativa AAK PibMagnaporthe griseaOryza sativa BAA76281 Xa1Xanthomonas oryza p.v. oryzae Oryza sativa T00020 Pto Pseudomonas syringae p.v. tomato Lycopersicon esculentum AAF Rpg1Hordeum vulgarePuccinia graminis f.sp. tritici AAM

17 Sekwencje referencyjne (przeszukiwanie BLASTP): KlasaGenPatogenŻywicielACC Cf-9 Cladosporium fulvum Lycopersicon pimpinellifolium CAA Xa21 FLS2 flagellin receptor Arabidopsis thaliana NP_ Xa21Xanthomonas oryzae p.v. oryzae Oryza sativa T04313 SA-CC RPW8.1Erysiphe cichoraceum Arabidopsis thaliana AAK RPW8.2Erysiphe cichoraceum Arabidopsis thaliana AAK

18 Rezultaty przeszukiwania (BLASTP i HMMer): KlasaLiczebność TIR1 CC-NBS-LRR*109 CC-NBS *70 NBS-LRR*265 NBS*153 Pto545 Xa21369 (304)* Cf9242(91)* SA-CC0 * Wliczając białka o fragmentarycznych NBS. ** W nawiasie liczba przypadków w których przewidziano domenę TM w prawidłowej orientacji.

19 Lokalizacja RGA na chromosomach:

20

21 Podsumowanie i uwagi: 1. Z przewidywanych przez IRGSP genów - około 2,7% (1744 sekwencje) są analogami genów R. 2. Przewidywane 597 sekwencji kodujących białka z domeną NBS, jest bardzo bliskie 600 sekwencjom uzyskanym w pierwotnym szacunku dla draft sequence ryżu (IRGSP, 2001). Rozkład tych sekwencji na chromosomach pokrywa się z częstościa występowania znanych genów R u ryżu. 3.Interesujące jest skupienie dużej liczby RGA zawierających domenę NBS na chromosomie 11 (28% znanych genów odpornościowych ryżu jest na chromosomie 11). An assessment of the resistance gene analogues of Oryza sativa ssp. japonica – their presence and structure Koczyk G., Chełkowski J. Cell Mol Biol Lett. 2003; 8(4):963-72

22 Przyszły kierunek: 2.Analiza genomu pszenicy przy pomocy znalezionych sekwencji ryżu (ze szczególnym uwzględnieniem sekwencji zawierających NBS) – obecny temat. 1.Szczegółowe badanie chromosomu 11 (duża liczba potencjalnych genów R, interesujące warianty strukturalne) – dla dokładniejszej sekwencji ryżu. 3.Uwagi: potrzeba wzięcia pod uwagę szybko zmiennych, olbrzymich ilości danych – klastrów EST (znaczna część danych) analiza sekwencji na poziomie DNA (nie białka) niemożliwe wyszukiwanie pełnych domen (średnia długość EST około 500 nt)

23 Nucleotide Binding Site – potwierdzone, znane motywy: MotywNajlepsze dopasowanie P-loop VVSIVGFGGLGKTTLAQxVYN Kin-2 KRYLIVIDDVW RNBS-B GSRIIVTTRIxxVAK GLPL CGGLPLAIKTIASLL RNBS-D CFLYLSLFPED

24 EST fishing: Selekcja 153 sekwencje zawierające NBS, z chromosomów 11 i 12 Oryza sativa ssp. japonica Przeszukiwanie >560,000 ESTs (etykietek ekspresyjnych) pszenicy. Ekstrakcja charakterystycznych, zakonserwowanych w ewolucji motywów

25 Poszukiwany kandydat - przykład: gi| |gb|BJ |BJ LENGTH = 672 COMBINED P-VALUE = 1.62e-26 E-VALUE = 8.1e-21 DIAGRAM: 241_[+1b]_177_[+2b]_158 [+1b] P-loop 2.4e-20 V..V..S..I..V..G..M..G..G..L..G..K..T..T..L..A..Q..Q..V..Y T..V..S..I..V..G..F..G..G..M..G..K..T..T..L..A..K..A..V..Y. 226 GAAGCATCCATTGAAGACGGTTTCTATTGTTGGATTTGGTGGGATGGGCAAGACAACTCTTGCCAAAGCAGTGTA obszar potencjalnie zmienny (projektowanie primera).N.. +.D TGACAAGCTCAAAGTGCAATTTGATTGTGGTGCCTTTGTTTCAGTTTCTCAAAATCCCGACATCAAGAAGGTTTT [+2b] Kin-2 6.8e-15 K..R..Y..F..I..V..I..D..D..V..W K..R..Y..L..I..V..I..D..D..I..W GATCGATGAAATCATTGAATTTCTTAATGACAAGAGGTATCTCATCGTAATTGATGATATATGGAATGAAAAATC -konserwatywne, dobrze dopasowane wystąpienia motywu -podobieństwo do znanych genów odpornościowych

26 EST fishing: Selekcja 153 sekwencje zawierające NBS, z chromosomów 11 i 12 Oryza sativa ssp. japonica Przeszukiwanie > ESTs (etykietek ekspresyjnych) pszenicy. Ekstrakcja charakterystycznych, zakonserwowanych w ewolucji motywów (program MEME) Konstrukcja primerów na podstawie rejonów zmiennych pomiędzy konserwatywnymi motywami.

27 Transgeneza i genomika roślin uprawnych Założona pod koniec 2003 roku Sieć Naukowa KBN. Skupia zespoły naukowe z Poznania, Warszawy, Wrocławia, Radzikowa... Poświęcona promocji wyników badań, koordynacji współpracy między ośrodkami członkowskimi, tworzeniu i upowszechnianiu analiz bioinformatycznych.

28 Transgeneza i genomika roślin uprawnych -porównywanie sekwencji (BLAST, WU-BLAST, CLUSTAL) -wyszukiwanie domen (HMMer, WISE-2.2, PRODIV-TMHMM) -wyszukiwanie zakonserwowanych motywów (MAST/MEME) -rekonstrukcja filogenezy (PHYLIP, NJTREE) -analiza sekwencji (EMBOSS) -predykcja struktury drugorzędowej białek (PSIPRED) -wyszukiwanie powtórzonych sekwencji (RepeatMasker) Aktualny projekt badawczy: analiza zdarzeń insercji/delecji w genomach Arabidopsis thaliana Col-0 i Ler Klastr obliczeniowy Końcówka Serwer sieciowy/ Serwer baz danych

29 Dziękuję za uwagę


Pobierz ppt "Grzegorz Koczyk (2004) Analogi genów odpornościowych Oryza sativa – ich występowanie i struktura. Everything should be made as simple,"

Podobne prezentacje


Reklamy Google