Pobieranie prezentacji. Proszę czekać

Pobieranie prezentacji. Proszę czekać

Geny i testy Ewa Bartnik Instytut Genetyki i Biotechnologii, Wydział Biologii UW i IBB PAN.

Podobne prezentacje


Prezentacja na temat: "Geny i testy Ewa Bartnik Instytut Genetyki i Biotechnologii, Wydział Biologii UW i IBB PAN."— Zapis prezentacji:

1 Geny i testy Ewa Bartnik Instytut Genetyki i Biotechnologii, Wydział Biologii UW i IBB PAN

2 Przed DNA testowano fenotypy i/lub metabolity a także oglądano chromosomy. 1.Słony pot/skóra -mukowiscydoza 2.Czarny mocz - alkaptonuria 3.Zielony pierścień wokół źrenicy – nagromadzanie miedzi, choroba Wilsona 4.Test wysokiego poziomu fenyloalaniny w krwi 5.Chromosomy – zespół Downa, trisomie chr. 13 i 18; XO, XXY)

3 1.Testy biochemiczne – oznaczenie enzymów lub metabolitów 2.Testy cytogenetyczne – nie tylko liczba chromosomów, także drobne zmiany 3.Testy DNA/RNA – czy są obecne mutacje To obejmuje: 10/30/071,464 testów genetycznych (www.genetests.org)www.genetests.org Obecnie 2039 plus 265

4 Badania cytogenetyczna Coraz mniejsze rzeczy można wykrywać Delecje Inwersje Translokacje Zmiana liczby chromosomów Zespół Downa

5 1. Predykcyjne 2. Diagnostyczne 3. Nosicielstwo 4. Prenatalne 5. Preimplantacyjne 6. Skrining noworodków Typy testów

6 Testy Genetyczne ? ? Diagnostyczne Przedobjawowe Prenatalne = choroba Huntingtona

7 Choroba Huntingtona Ruchy Psychiatryczne zaburzenia Zaburzenia poznawcze

8 Categories of CAG Repeat Sizes …CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG… Unaffected “ Mutable ” Unaffected “ Reduced Penetrance ” Affected Repeat may be unstable when larger than 26 repeats

9 Czasem tylko wiedza, jeśli choroby nie można leczyć; czasem dopasowane leczenie, choć czasem dość archaiczne (hemochromatoza) Wykrycie mutacji u osoby może mieć konsekwencje dla całej rodziny Diagnostyczne Służy potwierdzeniu diagnozy u osoby z objawami choroby

10 Parę problemów: nieletni – HD, rak piersi, rak tarczycy może wpływać na wiele rzeczy może być bardzo trudne do zniesienia (psycholog itp.) Testy predykcyjne Osoby bez objawów, ale obciążający wywiad rodzinny Dwa typy Przedobjawowe – rozwój choroby jest pewny jeśli jest obecna mutacja (HD) Predyspozycji – rozwój choroby jest możliwy (różne prawdopodobieństwa) (rak piersi, TP53, HNPCC)

11 WYMAGA PORADNICTWA GENETYCZNEGO BY WYNIK BYŁ ZROZUMIANY Badanie nosicielstwa Choroby o recesywnym sposobie dziedziczenia – 1 mutacja nie daje efektu ale może być przekazywana potomstwu Proponuje się osobom, z rodzin w których wystąpiła taka choroba Jeśli testuje się oboje przyszłych rodziców – można określić ryzyko urodzenia chorego dziecka (lub jeśli badana osoba nie jest nosicielem – wykluczyć)

12 Prenatalne Kobiety powyżej pewnego wieku (na ogół 35 lat); osoby z rodzin z obciążonym wywiadem; czasem po badaniu przesiewowym (genetyczne USG, testy potrójne itp.) Płyn owodniowy lub kosmki

13 Od kilku do kilkudziesięciu chorób Badania przesiewowe noworodków Wczesne wykrywanie potencjalnych problemów Kropla krwi z pięty niemowlaka Rodzice informowani tylko przy wyniku dodatnim Dodatni wynik nie przesądza, że dziecko chore; wymagane dalsze testy

14 A więc do czego można wykorzystać sekwencjonowanie  Medycyna  Sekwencjonowanie de novo całych genomów  Sekwencjonowanie eksomów  Resekwencjonowanie  Poznanie genetycznych podstaw chorób  Badania ewolucyjne, kryminalistyka, badanie pokrewieństwa

15 Przykład bardzo dobry Fenyloketonuria Niemowlęta na całym świecie Wczesne wykrycie i dieta chronią przed niepełnosprawnością umysłową

16 Przykłady markerzastosowanie Mukowiscydoza CFTR-G551D I 8 innych wariantów Lek skuteczny tylko u pacjentów z tymi mutacjami HIV HLA-B*5701Unikać abcavir; inny mniej toksyczny lek Czerniak – BrAF V600E/KLek skuteczny tylko u pacjentów z tymi wariantami Rak płuca EGFRLek skuteczny tylko u pewnych pacjentów

17 Biobanki Świadoma zgoda – ale co jeśli badania trwają 20 lat? Albo pojutrze ktoś wymyśli nowy test?

18 Biobanki Poufność danych 23andMe Sprzedaż firmom Nastolatek znalazł ojca który wcale tego nie planował bo był anonimowym dawcą spermy

19 Zbieranie próbek i danych Kto ma dostęp? Gymrek et al. – 10% zidentyfikowano Niszczyć, trzymać, zabezpieczać?

20 57 genów American College of Medical Genetics and Genomics 57 – Alzheimer, BRCA1, inne nowotwory, nawet nieletnim Lepsze pomysły – parę opcji przy teście

21 Testy DTC – direct to consumer Większość genów daje niewielkie ryzyko ◦ Bada się kilka – a wpływ może mieć wiele

22 Problemy z DTC Genetyka jest trudna Dla ogromnej większości chorób nie znamy genów – a dokładniej nie wszystkie (cukrzyca) Nie należy badać nieletnich chyba że to coś wnosi (nie badać nieuleczalnych chorób/chorób które ujawnią się dużo później u dorosłych) Geny otyłości i dieta

23 Nieletni W diagnostyce i w opiece zdrowotnej, przesiewowe badanie genetyczne i testy osób niepełnoletnich i dorosłych, które nie są w stanie wyrazić zgody, będą na ogół tylko wtedy do zaakceptowania pod względem etycznym, gdy będą miały poważne znaczenie dla stanu zdrowia danej osoby i gdy będzie brany pod uwagę jej nadrzędny interes.

24 IVF itd

25 Definicja Niemożność zajścia w ciążę przez rok 10-15% populacji % z tej grupy – nie wiadomo dlaczego

26 Przyczyny bezpłodności u kobiet Jajnik Jajowody Macica Szyjka macicy Hormony Chromosomy

27 Dlaczego zależy od wieku? Mniej komórek jajowych Gorsza jakość

28 Inne –Chromosomy –Zespół Turnera (XO) Niewrażliwość na androgeny (XY)

29 Mężczyźni - plemniki Produkcja Funkcja Niedrożność

30 Ile trzeba plemników do zapłodnienia Naturalne Intra-uterine insemination – In-vitro fertilization (IVF) –10000 Intra-cytoplasmic sperm injection (ICSI) –1

31 Wstępna ocena Komórki jajowe –Owulacja (Progesteron) –Jakość kom jajowych(FSH, Estradiol) Plemniki –Obecność –Jakość

32 Historia IVF 1978 Louise Joy Brown, first IVF baby 1981 Elizabeth Carr, first IVF baby in USA 1983 First birth after egg donation 1985 First birth from cryopreserved embryo 1985 Transvaginal ultrasound for follicle monitoring 1990 First report of births after PGD 1990 First report of egg donation to older mothers 1992 First human birth after ICSI

33 IVF - kiedy Inne terapie nieskuteczne Uszkodzone jajowody Problemy z plemnikami Brak macicy Nosiciele chorób genetycznych Osoby chore na raka “Nietradycyjne” “lifestyles”

34 Nadmiarowe zarodki Zamrożone Przeznaczone do badań/komórek macierzystych Do adopcji Wyrzucane

35 Dodatkowe procedury Intracytoplasmic sperm injection (ICSI) Preimplantation genetic diagnosis (PGD) Zamrażanie Dawstwo kom. Jajowych Matki zastępcze

36 Dawczynie kom jajowych lat Zdrowa

37 Komu? Premature ovarian failure Niewydolne jajniki (e.g. FSH>15 ) Menopauza Wiek ponad 43 lata Nieudane IVF

38 Matki zastępcze - surogatki Brak macicy Nienormalna macica Przeciwskazania do ciąży Nieudane ciąże lub IVF

39 Surogatki Przyjaciółki lub rodzina Agencje Wiek nie taki ważny Już rodziły i mają dzieci Ocena pod kątem psychologicznym

40 –Ryzyko dla kobiety –Ile jeszcze pożyje matka Jaka jest „granica fizjologiczna” Kiedy jest się za starą?

41 PGD Pierwszy opis Handyside, Winston, Hughes 1990 Do 2003, około >1000 narodzin po PGD (ESHRE Task Force, 2003)

42 PGD – wskazania kliniczne Monogeniczne choroby Translokacje zrównoważone Wiek kobiety – aneuploidia

43 Liczba urB def Total % IVF % PO KOREKCIE IVF 1.07ICSI 1,57 ART. BEZ I VITRO 1.24SUFERTILE BEZ INGERENCJ I 1.29

44 Figure 1 Trends in Endocrinology & Metabolism , 5-7DOI: ( /j.tem ) Copyright © 2013 Elsevier Ltd Terms and Conditions Terms and Conditions

45 Gene Therapy

46 Types of viral vectors Retrovirus Lenti-virus Adenovirus Adeno-Associated virus (AAV) Herpes virus

47 In vivo and ex vivo gene therapy

48 Clinical trial stages I – safety and dose evaluation healthy volunteers II side effects, effectiveness– 2 years patients-volunteers III – effectiveness, long-term effects,– 3 years ; patients-volunteers

49 Poza terapią genową RNA, które powodują degradację RNA „złych” genów Białka itp. przeciw konkretnemu białku (Gleevec przy pewnej formie białaczki, w której przez translokację powstaje gen, dający nieobecny w normalnych komórkach produkt białkowy) Monoklonalne przeciwciała przeciw niepożądanym białkom


Pobierz ppt "Geny i testy Ewa Bartnik Instytut Genetyki i Biotechnologii, Wydział Biologii UW i IBB PAN."

Podobne prezentacje


Reklamy Google