Pobieranie prezentacji. Proszę czekać

Pobieranie prezentacji. Proszę czekać

DIAGNOSTYKA MOLEKULARNA. METODY MOLEKULARNE  PCR  Hybrydyzacja  FISH  Sekwencjonowanie.

Podobne prezentacje


Prezentacja na temat: "DIAGNOSTYKA MOLEKULARNA. METODY MOLEKULARNE  PCR  Hybrydyzacja  FISH  Sekwencjonowanie."— Zapis prezentacji:

1 DIAGNOSTYKA MOLEKULARNA

2 METODY MOLEKULARNE  PCR  Hybrydyzacja  FISH  Sekwencjonowanie

3 ŁAŃCUCHOWA REAKCJA POLIMERAZY Polimerase Chain Reaction (PCR)  Pozwala na powielenie dowolnej sekwencji DNA o długości od kilkuset do kilku tysięcy nukleotydów  Polega na przeprowadzeniu wielu cykli syntezy kwasu nukleinowego z wykorzystaniem starterów flankujących określony odcinek DNA

4 MECHANIZM REAKCJI CZYNNIKI:  Matryca DNA  Startery (primery)  dNTP (trójfosforany deoksynukleotydów)  Polimeraza DNA

5 IZOLACJA 1.Przygotowanie próbek krwi, skóry itd. 2.Dezintegracja komórek – TRIZOL, Chloroform 3.Odwirowanie zanieczyszczeń 4.Zamrożenie ( C)

6 STARTERY  Starterem nazywany jest oligonukleotyd zbudowany z 6 do 40 zasad nukleotydowych, którego sekwencja jest komplementarna z badaną matrycą DNA lub RNA. Startery o długości ponad 18 nukleotydów w sposób wybiórczy mogą hybrydyzować z sekwencją komplementarną, jeśli nawet pojedyncze kopie matrycy zmieszane są z milionami innych cząsteczek DNA. Koniec 3' przyłączonego startera wyznacza początek replikacji DNA.

7 CYKL PCR 1.Denaturacja DNA ( C) 2.Przyłączanie starterów do matrycy ( C) 3.Polimeryzacja DNA (72 0 C )

8 DENATURACJA (> 90 0 C)

9 PRZYŁĄCZANIE STARTERÓW ( C) Sekwencja duplikowana Starter 1 Starter 2 5’ 3’ 5’ 3’ 5’ 3’

10 WYDŁUŻANIE ŁAŃCUCHÓW (72 0 C) Sekwencja duplikowana Primer 1 Primer 2 5’ 3’ 5’ 3’ 5’ 3’ Polimeraza Taq DNA Wolne nukleotydy

11 POWIELONA SEKWENCJA DNA

12 LICZBA KOPII SEKWENCJI DNA PODCZAS REAKCJI PCR Cykle Liczba łańcuchów DNA ,048, ,073,741,824

13

14 PROFIL TERMICZNY PCR DENATURACJA (ok. 1 minuty) PRZYŁĄCZANIE STARTERÓW (ok. 30 sekund) POLIMERYZACJA (ok. 30 sekund) DENATURACJA (ok. 1 minuty)

15 METODY DIAGNOSTYCZNE OPARTE NA PCR  PCR  PCR MULTIPLEKSOWY: Równoczesna amplifikacja kilku regionów genomu w jednej probówce stosując różne pary starterów. (Diagnostyka chorób genetycznych, wykrywanie mutacji, wykrywanie czynników zakaźnych)

16  NESTED PCR: Dodanie zestawu nowych (bardziej swoistych) starterów po przeprowadzeniu wstępnej reakcji PCR. (Kontrola swoistości reakcji, stworzenie sondy molekularnej z produktu PCR)

17  Real Time PCR: Analiza ilościowa badanego fragmentu genomu z wykorzystaniem barwników fluorescencyjnych (np. SYBR Green). Po każdym cyklu barwnik łączy się z 2- niciowym produktem, dzięki czemu możliwe jest określenie jego ilości (w czasie rzeczywistym).

18  PCR-RFLP Produkt PCR jest poddawany procesowi cięcia enzymami restrykcyjnymi, w wyniku czego otrzymuje się fragmenty DNA różnej długości, które następnie rozdziela się elektroforetycznie. Już zmiana pojedynczego nukleotydu w sekwencji rozpoznawanej przez enzym (restryktazę) spowoduje, że nie dokona on rozcięcia DNA -> Inny rozkład prążków w żelu.

19  RT-PCR Umożliwia przeprowadzenie PCR-u na RNA: 1 etap to odwrotna transkrypcja (przepisanie informacji z RNA na DNA, dzięki enzymowi: odwrotna transkryptaza) 2 etap to standardowy PCR

20 ODWROTNA TRANSKRYPCJA (RT-PCR) Mieszanina RT-PCR Wyizolowane RNA Odwrotna transkryptaza Nukleotydy (dNTP) Bufor z jonami (np. Mg) Stabilizator (DTT) Stała temperatura (37 0 C) w czasie 30 min.

21 Nazwa i pochodzenie enzymu Jon aktywujący Uwagi Tth Polymerase <- Thermus thermophilus Mn++ Termostabilna, z jonami Mg wykazuje aktywność polimerazy DNA MMuLV Reverse Transcriptase <- Moloney Murine Leucemia Virus Mg++ najpowszechniej stosowana odwrotna Transkryptaza AMV Reverse Transcriptase <- Avian Myeloblastosis Virus Mg++ Coraz powszechniej stosowana odwrotna Transkryptaza Cth Polymerase Klenow <- Fragment Carbohydrothermus hydrogenoformans Mg++ Stosowana w mieszaninie z Taq polimerazą do jednostopniowej reakcji RT-PCR

22  ASYMETRYCZNY PCR: Dodanie pary starterów z których jeden zostaje całkowicie zużyty podczas pierwszych cykli amplifikacji DNA. (Produkt może być sondą molekularną w reakcji hybrydyzacji lub matrycą w reakcji sekwencjonowania.)  AMPLIFIKACJA ALLELOSPECYFICZNA: Ważna jest tu komplementarność nukleotydów przy końcach 3` primerów, ponieważ umożliwia ona elongację DNA przez polimerazę. (Badanie polimorfizmu alleli, punktowych mutacji, powiązań genetycznych, wyjaśnienie działania substancji mutagennych, wykrywanie genów sprzężonych z chorobami, badanie lekooporności mikroorganizmów

23  ELEKTROFOREZA Elektroforeza kwasów nukleinowych obecnie przeprowadzana jest głównie na żelach agarozowym i akryloamidowym oraz w tzw. płynnych (nisko spolimeryzowanych) żelach akryloamidowych w kapilarach. ANALIZA PRODUKTÓW PCR

24  JAK DZIAŁA? DNA nałożony na żel agarozowy zachowuje się jak ujemnie naładowana cząsteczka o dużej masie. Wędruje w kierunku anody (bieguna dodatniego), a migracja jest hamowana przez sieć agarozową proporcjonalnie do wielkości cząsteczki DNA. DNA nałożony na żel agarozowy zachowuje się jak ujemnie naładowana cząsteczka o dużej masie. Wędruje w kierunku anody (bieguna dodatniego), a migracja jest hamowana przez sieć agarozową proporcjonalnie do wielkości cząsteczki DNA.

25

26  ELEKTROFOREZA AKRYLOAMIDOWA Jest powszechnie, chociaż niesłusznie uważana za bardziej precyzyjną od agarozowej oraz (słusznie) za tańszą. Zaletami tego podłoża są niskie koszta oraz możliwość wybarwiania rozdzielonych frakcji DNA poprzez srebrzenie, które daje wyraźne, widoczne gołym okiem i trwałe obrazy.

27 ŻELE AKRYLOAMIDOWE

28 Barwienie żeli może być przeprowadzane za pomocą bromku etydyny lub innego, podobnego barwnika (np. SYBR Gold, który jest o wiele czulszy lecz znacznie droższy), natomiast w przypadku elektroforezy kapilarnej szczególnie popularne jest wielokolorowe barwienie fluorescencyjne, wykorzystujące wzbudzoną laserem fluorescencję wbudowanych w łańcuch DNA fluorochromów.

29 PODSUMOWANIE:  PCR umożliwia kopiowanie DNA startując z b małych ilości.  Reakcja opiera się na cyklicznych zmianach temperatury środowiska reakcyjnego.  Polimeraza DNA amplifikuje (kopiuje) DNA przy współudziale starterów.  Wyniki otrzymujemy najczęściej z wykorzystaniem elektroforezy.

30 HYBRYDYZACJA Wykorzystuje sondy molekularne (kwas nukleinowy o określonej sekwencji), będące odcinkami komplementarnymi do szukanych fragmentów genomu.

31  Technika, która pozwoliła na wierne przeniesienie DNA z żelu na podłoże umożliwiające wykonanie hybrydyzacji, nosi nazwę Southern blot. Nazwa tej techniki pochodzi od nazwiska jej wynalazcy, E.M. Southerna, oraz od pomysłu polegającego na wykorzystaniu zjawiska włosowatości dla wymuszenia wędrówki DNA, podobnie jak przy wciąganiu plamy wody przez bibułę. Biolodzy molekularni szybko nazwali transfer rozdzielonego elektroforetycznie RNA - Northern blot, a transfer białka - Western blot.

32 HYBRYDYZACJA METODĄ SOUTHERN BLOT

33

34 Mikromacierz nylonowa 8 x 12 cm Mikromacierz nylonowa (powiększenie) 4 x 5 mm  

35 Nowoczesne mikromacierze Powiększenie 

36 SONDY MOLEKULARNE

37

38  HYBRYDYZACJA in situ (FISH) Pozwala zlokalizować sekwencję kwasu nukleinowego w komórce lub odpowiednim rejonie chromosomu. Znakomita większość sond wykorzystywanych w metodzie FISH znakowana jest bezpośrednio fluorochromem. Najczęściej stosowanymi fluorochromami są fluoresceina (FITC), rodamina, czerwień teksańska (Texas Red) i Aqua (DEAC).

39 Obraz chromosomów komórek linii raka prostaty  Metoda M-FISH Hybrydyzacja in situ multipleksowa 

40 Hybrydyzacja in situ genu Pax3 (zarodek myszy)

41 Hybrydyzacja in situ gadzich komórek wątroby (wykrywanie adenowirusów)

42 SEKWENCJONOWANIE Polega na określeniu sekwencji nukleotydów w łańcuchu DNA

43 Metoda chemiczna – chemiczne rozszczepianie kolejnych nukleotydów badanego fragmentu DNA.

44 Metoda enzymatyczna (Sangera) – synteza komplementarnej nici DNA na matrycy wykorzystująca system znakowania trójfosforanów czterech dideoksynukleotydów fluorochromami w czterech różnych kolorach oraz PCR, są 3 warianty:

45 1. Dye Primer Sequencing- przeprowadza się cztery niezależne reakcje PCR z czterema porcjami primera, każda porcja znakowana jest fluorochromem w innym kolorze. Produkty czterech reakcji miesza się i analizuje wspólnie. 1. Dye Primer Sequencing - przeprowadza się cztery niezależne reakcje PCR z czterema porcjami primera, każda porcja znakowana jest fluorochromem w innym kolorze. Produkty czterech reakcji miesza się i analizuje wspólnie. 2. Cycle Sequencing - startuje się z bardzo małą ilością DNA, przeprowadza reakcję PCR, a po każdej denaturacji termicznej uzyskuje się coraz dłuższy łańcuch zakończony znakowanym nukleotydem. 3. Dye Terminator Sequencing - używa się mieszanki nie znakowanych trójfosforanów nukleotydów i znakowanych trójfosforanów dideoksynukleotydów. Była stosowana przez konkurujące zespoły naukowe które z sukcesem zakończyły sekwencjonowanie genomu człowieka.

46 Starter komplementarny do matrycy DNA 3’ 5’ 3’ GCCTAGGGTTTGCGCTAC Wydłużanie startera przy użyciu polimerazy DNA CGGATCCCAAACGCGATGCAGGCATGCAATGACC Schemat automatycznego sekwencjonowania DNA dATP dGTP dTTP dCTP ddCTP ddTTP ddATP ddGTP Terminatory znakowane fluorescencyjnie ddG GTddC GddT GTCCddG GTCddC GTCCGddT GTCCGTddA GTCCGTACddG GTCCGTAddC GTCCGTACGddT GTCCGTACGTddT GTCCGTACGTTddA GTCCGTACGTTAddC GTCCGTACGTTACddT GTCCGTACGTTACTddG GTCCGTACGTTACTGddG Laser Detektor Rozdział produktów reakcji w automatycznym sekwenatorze

47 Metoda Sangera

48 Typowe obrazy wyświetlane przez sekwencjonometr

49 =*=-=*=-=*=-=*=-


Pobierz ppt "DIAGNOSTYKA MOLEKULARNA. METODY MOLEKULARNE  PCR  Hybrydyzacja  FISH  Sekwencjonowanie."

Podobne prezentacje


Reklamy Google