Pobieranie prezentacji. Proszę czekać

Pobieranie prezentacji. Proszę czekać

ELEKTROFOREZA – ruch jonów i makromolekuł obdarzonych ładunkiem elektrycznym poprzez medium w wyniku przyłożonego napięcia Dla liniowej cząsteczki szybkość.

Podobne prezentacje


Prezentacja na temat: "ELEKTROFOREZA – ruch jonów i makromolekuł obdarzonych ładunkiem elektrycznym poprzez medium w wyniku przyłożonego napięcia Dla liniowej cząsteczki szybkość."— Zapis prezentacji:

1

2 ELEKTROFOREZA – ruch jonów i makromolekuł obdarzonych ładunkiem elektrycznym poprzez medium w wyniku przyłożonego napięcia Dla liniowej cząsteczki szybkość migracji jest odwrotnie proporcjonalna do log z masy cząsteczkowej Czynniki wpływające na szybkość migracji w żelu: Wielkość cząsteczki Konformacja D|NA Koncentracja agarozy Wartość przyłożonego napięcia Skład nukleotydów i temperatura Obecność barwników interkalujących Skład i siła jonowa buforu do elektroforezy

3

4 RFLP – restriction fragment length polimorphism Najwcześniejsza i główna metoda detekcji zmienności genetycznej na poziomie DNA Metoda ta oparta jest na enzymach restrykcyjnych izolowanych z różnorodnych gatunków bakterii Enzymy te rozpoznają specyficzną sekwencje, zwykle 4-6 par zasad i rozcinają symetrycznie obydwie nici DNA na zdefiniowane i powtarzalne fragmenty

5

6 Co daje nam trawienie restrykcyjne? Fragmenty DNA na żelu w postaci prążków o identycznej sekwencji Precyzyjna obróbka DNA, powtarzalność fragmentacji cząsteczki Jest podstawą do mapowania genetycznego Identyfikacja mutacji, diagnostyka Rekombinowanie i klonowanie genów

7 RFLP – Protokół Izolacja jądrowego (mt) DNA Trawienie enzymem restrykcyjnym w optymalnych warunkach dla działania restryktazy Rozdział fragmentów w procesie elektroforezy na żelu agarozowym Southern blotting – detekcja specyficznych prążków

8 Southern blotting Metoda oparta na hybrydyzacji kwasów nukleinowych metoda czasochłonna, stosunkowo droga ale bardzo specyficzna Na pełną analizę składa się 5 etapów: 1)Trawienie restrykcyjne – enzym dodawany jest do próbki DNA 2)Elektroforeza – mieszanina fragmentów restrykcyjnych rozdzielana jest w procesie elektroforezy. DNA z każdej próbki tworzy charakterystyczny układ prążków 3)Blotting – przeniesienie pasma cząsteczek DNA na nitrocelulozowy lub nylonowy filtr przy wykorzystaniu sił kapilarnych 4)Hybrydyzacja z radioaktywną sondą – inkubacja filtra w roztworze zawierającym znakowana sondę DNA w celu wykrycia tych fragmentów, które zawierają sekwencje komplementarne do sondy 5)Autoradiografia – ekspozycja kliszy rentgenowskiej na promieniowanie izotopów zawartych w sondzie zlokalizowanej na filtrze.

9

10 Autoradiogram analizy Southern-blotting

11 DOT-BLOT technika ta wykorzystywana jest do bezpośredniej detekcji mutacji próbki DNA nanoszone są na membranę w dwóch powtórzeniach i hybrydyzowane z sondą wyznakowana radioaktywnie dla allelu dzikiego oraz zmutowanego po hybrydyzacji naświetla się film rentgenowski wykorzystując iluminację pochodzącą z membrany technika prosta, relatywnie szybka ale czasem daje zbyt duże tło

12 Aparatura do dot- blot’u

13

14 PCR – łańcuchowa reakcja polimeryzacji technika ta umożliwiła rozwój technik molekularnych oraz możliwość różnorodnej manipulacji na poziomie DNA umożliwia uzyskanie niezwykle dużej liczby kopii danej sekwencji DNA w krótkim czasie teoretycznie dla PCR wystarczy tylko jedna cząsteczka docelowa

15 Składniki potrzebne do reakcji PCR: Bufor – utrzymuje mieszaninę reakcyjną w pH potrzebnym do zajścia reakcji jony Mg ++ – niezbędne do właściwego działania Polimerazy Deoxynukleotydy (dNTP) – substraty dla DNA Polimerazy (dATP, dGTP, dCTP, dTTP) – niezbędne do budowania nowego łańcucha DNA Startery – specyficzne oligonukleotydy komplementarne do fragmentów flankujących region DNA który chcemy amplifikować Taq DNA Polimeraza – termostabilny enzym dobudowujący nowe deoxynukleotydy do matrycy Matryca DNA - DNA które ma być amplifikowane podczas reakcji Woda NAJCZĘŚCIEJ TO SEKWENCJA I STĘŻENIE STARTERÓW DECYDUJE O POWODZENIU REAKCJI

16 PCR – reakcja cykliczna : Na reakcję PCR składają się 3 główne kroki, które powtarzane są razy. Reakcję przeprowadza się w automatycznym cyklerze, który potrafi bardzo szybko zmieniać temperaturę otoczenia próbki. 1) Denaturacja w 94°C : Podczas denaturacji przez podgrzewanie DNA zrywane są połączenia pomiędzy łańcuchami – w wyniku czego cząsteczka DNA rozdziela się na 2 nici

17 PCR – reakcja cykliczna : 2) Przyłączanie starterów w 40 O C-60 O C (Annealing): Mieszaninę chłodzi się do określonej temperatury, w której startery mogą utworzyć dwuniciowe struktury hybrydowe na końcu każdej nici DNA. Każdy ze starterów wiąże się tylko z jedną nicią wyjściowego DNA

18 3) Elongacja w 72°C : W tej temperaturze zachodzi optymalna polimeryzacja z wykorzystaniem zawartych w mieszaninie reakcyjnej nukleotydów. Polimeraza DNA kopiuje każdą jednoniciową matrycę przez wydłużanie każdego ze starterów w kierunku od 3’ do 5’. PCR – reakcja cykliczna : Po elongacji gotowa jest kompletna nowa cząsteczka DNA składająca się w połowie z nowej a w połowie ze starej nici i proces może zacząć się od początku

19 Maszyna do PCR - termocycler

20

21 zastosowanie PCR w analityce medycznej do wykrywania specyficznych fragmentów DNA o określonej długości (np. multiplex PCR-STR) do wykrywania zmian we fragmentach DNA (najczęściej w połączeniu z inną techniką)

22 PCR-RFLP Amplifikacja ze specyficznymi primerami Detekcja produktów przy użyciu elektroforezy poziomej na żelu agarozowym Inkubacja z enzymem restrykcyjnym w specyficznych dla niego warunkach Rozdział produktów trawienia w procesie elektroforezy poziomej na żelu agarozowym Analiza wyników

23

24 Wynik analizy PCR-RFLP

25 wynik analizy PCR-RFLP dla VDR

26 Zalety PCR-RFLP Bardzo dobra metoda bezpośredniej detekcji mutacji punktowych, zwłaszcza SNP Metoda jest prosta, szybka i tańsza niż southern blotting Rezultaty PCR-RFLP są bardzo łatwe do interpretacji

27 PCR allelospecyficzna do diagnostyki określonej mutacji punktowej przeprowadza się dwie niezależne reakcje PCR: z jednym starterem zstępującym i dwoma wstępującymi primery wstępujące różnią się tylko jednym nukleotydem na końcu 3’ – który jest komplementarny do nukleotydu allelu prawidłowego lub patologicznego

28 SSCP – single-strand conformational polymorphism technika używana do detekcji małych delecji, insercji i innych punktowych mutacji pewne mutacje zaburzają drugorzędową strukturę ssDNA przez co zmieniają również ruchliwość danego fragmentu w żelu metoda ta pozwala rozróżnić podczas elektroforezy fragmenty o zmienionej sekwencji

29

30 Wynik analizy SSCP w rodzinie ze schorzeniem autosomalnym dominującym zmutowany allel dziki allel

31 SnapShot - protokół wstępna amplifikacja minisekwencjonowanie – reakcja z primerami zawierającymi wyznakowane nukleotydy rozdział w denaturującym żelu poliakrylamidowym z użyciem aparatu ABI 377 w obecności standardu wewnętrznego LIZ 120.

32 SnapShot umożliwia typowanie wielu markerów i polimorfizmów zlokalizowanych w jednym obszarze jednocześnie, co pozwala ograniczyć potrzebną ilość materiału wyjściowego oraz skrócić czas analizy Metoda polega na amplifikacji matrycy (produktu PCR) z użyciem primerów zaprojektowanych tak aby identyfikowany polimorfizm był umiejscowiony dokładnie jedną parę zasad za końcem primera.

33 Do mieszaniny reakcyjnej dodajemy tylko wyznakowane fluorescencyjnie, zmodyfikowane mononukleotydy – terminatory reakcji amplifikacji, dzięki czemu podczas reakcji powstają produkty o długości o jedną parę zasad dłuższe niż primer, wyznakowane barwnikiem fluorescencyjnym. Fluorochrom po wzbudzeniu światłem lasera emituje energię o określonej długości fali, przekładającej się na barwę charakterystyczną dla danego znacznika a tym samym wyznakowanej nim zasady.

34

35 Sekwencjonowanie DNA Metoda dideoksynukleotydowa (Sangera) opiera się na syntezie in vitro nici DNA komplementarnej do łańcucha sekwencjonowanego Kiedy Polimeraza wstawia dideoksynukleotyd do syntetyzowanego łańcucha to uniemożliwia jego dalsze wydłużanie ponieważ ddXTP nie posiada grupy –OH w pozycji 3’ dideoksyrybozy i niemożliwe jest utworzenie kolejnego wiązania fosfodiestrowego

36 Procedura Przygotowujemy 4 mieszaniny reakcyjne, z których każda zawiera: - matryce DNA – czysty produkt (najczęściej PCR), który ma być sekwencjonowany - Polimeraza DNA - jeden starter (ponieważ badana jest tylko jedna z nici) - mieszanina nukleotydów (dATP, dCTP, dGTP, dTTP) - jeden z dideoksy analogów nukleotydów wyznakowanych izotopem (2’-3’-dideoksypochodne trifosforanów nukleozydów ddNTP) Przeprowadza się 4 równoległe reakcje oznaczone „A”, „C”, „G”, „T”. W każdej jest jeden z didoksynukleotydów. Po skończonej reakcji próbki nakłada się na żel w sąsiadujących ścieżkach, gdzie migrują w polu elektrycznym proporcjonalnie do długości. Specjalne żele pozwalaja rozróżnić łańcuchy różniące się jednym nukleotydem.

37

38 GTTAGACAGACCTGACATGCTGACTTGCATGCGGAATGACTG ACCTGAAATG

39 Radiogram sekwencjonowania DNA metodą Sangera Rozdzielone łańcuchy poddaje się autoradiografii Sekwencję odczytuje się z radiogramu litera po literze

40 Automatyczne sekwencjonowanie DNA – procedura Przygotowujemy 1 mieszaninę reakcyjną, która zawiera: - matryce DNA – czysty produkt (najczęściej PCR), który ma być sekwencjonowany - Polimeraza DNA - jeden starter (ponieważ badana jest tylko jedna z nici) - mieszanina nukleotydów (dATP, dCTP, dGTP, dTTP) - mieszanina czterech dideoksynukleotydów wyznakowanych fluorochromem charakterystycznym dla danego dNTP Automatyczne sekwencjonowanie oparte jest na metodzie Sangera, a jedyną różnicą jest to, że wszystkie wyznakowane fluorescencyjnie ddNTP umieszczamy w jednej probówce.

41 Automatyczne sekwencjonowanie DNA Po reakcji w termocyklerze przeprowadzamy elektroforezę w denaturującym żelu poliakrylamidowym i rozdzielamy fragmenty według masy cząsteczkowej. Podczas tego procesu fluorochrom winkorporowany w ddNTP wzbudzany światłem lasera emituje energię o określonej długości fali, która sczytywana jest przez specjalną kamerę współpracującą z komputerem


Pobierz ppt "ELEKTROFOREZA – ruch jonów i makromolekuł obdarzonych ładunkiem elektrycznym poprzez medium w wyniku przyłożonego napięcia Dla liniowej cząsteczki szybkość."

Podobne prezentacje


Reklamy Google