Pobieranie prezentacji. Proszę czekać

Pobieranie prezentacji. Proszę czekać

Podsumowanie – wykład 3 1. Technologia DNA Enzymy restrykcyjne – endonukleazy Trawienie restrykcyjne i ligacja DNA Topoizomeraza I Enzymatyczna metoda.

Podobne prezentacje


Prezentacja na temat: "Podsumowanie – wykład 3 1. Technologia DNA Enzymy restrykcyjne – endonukleazy Trawienie restrykcyjne i ligacja DNA Topoizomeraza I Enzymatyczna metoda."— Zapis prezentacji:

1 Podsumowanie – wykład 3 1. Technologia DNA Enzymy restrykcyjne – endonukleazy Trawienie restrykcyjne i ligacja DNA Topoizomeraza I Enzymatyczna metoda sekwencjonowania (Metoda Sangera) 2. Metoda PCR Etapy reakcji Warunki reakcji ( startery, polimeraza Taq) Startery specyficzne i zdegenerowane Typy polimeraz Zastosowanie PCR 3. Przykłady modyfikacji PCR RT-PCR Multipleks PCR Odwrotny PCR Real Time PCR RACE PCR

2 Nukleazy restrykcyjne - endonukleazy Nukleazy restrykcyjne - endonukleazy enzymy, które katalizują hydrolizę wiązań fosfodiestrowych: tworząc końce 3OH i 5PO 4 rozcinają DNA tylko w miejscach, określonych przez krótkie sekwencje nukleotydów (od 4-8 par nukleotydów);sekwencje palindromowe; rożne szczepy bakterii zawierają różne nukleazy restrykcyjne- mechanizm obronny przed obcym DNA; Nukleazy restrykcyjne tępe końce lepkie końce Nazwy enzymów pochodzą od gatunków, z których zostały wyizolowane po raz pierwszy np. Heamophilus influanzae szczep Rd (Hind III) III- trzecia endonukleaza

3 Topoizomeraza I Topoizomeraza I – pochodzi z wirusa Vaccinia ; pełni jednocześnie fukncję endonukleazy i ligazy DNA rozpoznaje specyficzną sekwencję pentamerową 5-(C/T)CCTT-3 w naturze enzym ten uwalnia tzw. superskręty w dsDNA systemy komercyjne z liniowymi wektorami zawierają topoimomerazę I przyłączoną do końca 3 wektora, co ułatwia ligację i czyni ją bardziej efektywną ( 95 % w porównaniu do 60% z użyciem ligaz) Topoizomeraza I

4 PCR Etapy reakcji PCR Wstępna denaturacja ( 3min w 94°C) cykli, każdy składa się z: Denaturacji95°C1 min Hybrydyzacji50-60°C30-1min Elongacji (syntezy)72°C1-2 min Koniec reakcji – obniżenie temperatury do 4°C

5 MODYFIKACJE REAKCJI PCR RT-PCR – matrycą jest cDNA syntetyzowane z użyciem odwrotnej transkryptazy na bazie mRNA Multiplex PCR – umożliwia jednoczesne amplifikowanie kilku genów, konieczne jest dodanie do mieszaniny reakcyjnej kilku par starterów, produkty o różnej długości łatwo rozdzielić podczas elektroforezy – test do wykrycia mikroorganizmów w wodzie i pożywieniu Odwrotny PCR (inverse PCR)- amplifikacja fragmentów oskrzydlających z obu stron odcinek DNA; Real Time-PCR – ilościowy PCR, PCR z analizą ilości produktu w czasie rzeczywistym, umożliwia monitorowanie przebiegu reakcji PCR poprzez okreslanie ilosci powstajacego produktu w każdym cyklu z użyciem znaczników fluorescencyjnych np. SYBR-Green I RACE PCR-(Rapid Amplification cDNA-Ends)- amplifikacja 3 i 5 końców cDNA znanego fragmentu mRNA

6 Projektowanie starterów OBLICZANIE TEMPERATURY HYBRYDYZACJI 1. Zasada: °C x (A+T) + 4°C x (C+G) TACCTAGGTTGACCATCTACTAA TACCTAGGTTGACCATCTACTAA = 9 G+C TACCTAGGTTGACCATCTACTAA = 14 A+T Tm = 2°C x (14) + 4°C x (9) Tm = 28°C + 36°C = 64°C 2. Kalkulator

7 Kalkulator OligoAnalyzer 3.1

8 POLIMERAZY TAQ i PFU Syntezę DNA prowadzają polimerazy DNA najczęściej pochodzące z termostabilnych bakterii Bakterie Thermus aquaticus odkryto w 1969 roku w gorących źródłach Polimerazę DNA Taq wyizolowano z tych bakterii w 1976; maksymalna aktywność w temp °C, optimum: 72°C ; popełnia błąd średnio co 250 nukleotydów nie posiada aktywności naprawczej 3-5 egzonukleazy Okres półtrwania ponad 2 h (w 95° C) Polimeraza Pfu –polimeraza pochodząca z Pyrococcus furiosus, posiada aktywność korekcyjną egzonukleazy i dzięki temu wykazuje zredukowany wskaźnik błędów.


Pobierz ppt "Podsumowanie – wykład 3 1. Technologia DNA Enzymy restrykcyjne – endonukleazy Trawienie restrykcyjne i ligacja DNA Topoizomeraza I Enzymatyczna metoda."

Podobne prezentacje


Reklamy Google