Pobieranie prezentacji. Proszę czekać

Pobieranie prezentacji. Proszę czekać

Molekularna księga rodzaju O filogenetyce molekularnej, współczesnej nauce badania pokrewieństw miedzy organizmami Jan Kwiatowski Instytut Botaniki UW.

Podobne prezentacje


Prezentacja na temat: "Molekularna księga rodzaju O filogenetyce molekularnej, współczesnej nauce badania pokrewieństw miedzy organizmami Jan Kwiatowski Instytut Botaniki UW."— Zapis prezentacji:

1 Molekularna księga rodzaju O filogenetyce molekularnej, współczesnej nauce badania pokrewieństw miedzy organizmami Jan Kwiatowski Instytut Botaniki UW

2 ja i agawa Stopień pokrewieństwa może być oszacowany na podstawie podobieństwa Kłopot może sprawiać brak cech dostępnych do analizy porównawczej Jak różne są te dwa organizmy?

3 Euglena Ehrenberg 1830 Eugleny jak inne pierwotniaki są do siebie bardzo podobne morfologicznie, co bardzo utrudnia badania filogenetyczne tej grupy.

4 Moja córka jest bardzo podobna do mojej mamy

5 mój brat cioteczny moja siostra cioteczna ja moja siostra moja mama moja babcia moja ciocia Moi krewni po kądzieli

6 Odziedziczone podobieństwa nazywamy homologiami Nie ma kłopotu z ustaleniem relacji pokrewieństwa miedzy tymi organizmami

7 Czy ten morski ślimak jest bliżej spokrewniony z motylem czy z lwem? A jak jest z nicieniem? Jest bliżej spokrewniony ze mną czy z komarem? Na wiele tych i podobnych pytań nie mamy wciąż dobrej odpowiedzi. Łatwo zauważyć jak mało odpowiednie do szacowania stopnia pokrewieństwa są niekiedy cechy zewnętrzne

8 ja i agawa Jak różne są więc te dwa organizmy?

9 Gdy porównamy pewne sekwencje makrocząsteczek nie aż tak bardzo! Homo GTCTACGGCCATACCACCCTGAACGCGCCCGATCTCGTCTGATCTCGGAAGCTAAGCAGG Agave GGGTGCGATCATACCAGCACTAAGTCACCGGATCCCATCAGAACTCCGCAGTTAAGCGTG * * ** ******* * ** * ** **** * ** ** *** * ** ***** * Homo GTCGGGCCTGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGGGTGCTGTAGGCTT Agave CTTGGGCGAGAGTAGTACTGGGATGGGTGACCTCCTGGGAAGTCCTCGTGTTGCACCCTT * **** * ******* ******* **** ******** ** *** ** * *** 5S rDNA Prawie 70% pozycji w tym odcinku DNA jest identycznych. Więc różnię się od agawy tylko o 30%?

10 5S rDNA Homo GTCTACGGCCATACCACCCTGAACGCGCCCGATCTCGTCTGATCTCGGAAGCTAAGCAGG Agave GGGTGCGATCATACCAGCACTAAGTCACCGGATCCCATCAGAACTCCGCAGTTAAGCGTG * * ** ******* * ** * ** **** * ** ** *** * ** ***** * Homo GTCGGGCCTGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGGGTGCTGTAGGCTT Agave CTTGGGCGAGAGTAGTACTGGGATGGGTGACCTCCTGGGAAGTCCTCGTGTTGCACCCTT * **** * ******* ******* **** ******** ** *** ** * *** Nie są arbitralne, na ogół podlegają nieskomplikowanym naciskom selekcyjnych, bardzo łatwo je opisać liczbowo i są niezwykle obfite Dane molekularne są gotowe do analiz Można łatwo wybrać odpowiednią sekwencję Można stosunkowo łatwo zaproponować modele ich ewolucji w postaci równań matematycznych

11 Czas geologiczny Historia ziemi zapisana warstwami skał osadowych

12 Historia pisana kośćmi Sereno Science 284, 2137 (1999)

13 Historia zapisana aminokwasami alfa hemoglobina Mysz Chomik Człowiek Torbacz Krokodyl Mysz Chomik Szympans Torbacz Krokodyl Żaba Karp Rekin

14 Moi dalecy krewni Mysz Chomik Człowiek Torbacz Krokodyl Wspólny przodek wszystkich Chomik Mysz Ja i Szympans Torbacz Krokodyl Wspólny przodek ssaków Mysz Chomik Szympans Torbacz Krokodyl Torbacz Homo Chomik asmdk as l dk

15 Człowiek – Szympans 6 Chomik – Mysz 40 Człowiek – Gryzonie 75 Torbacz – Ssaki łożyskowe175 Krokodyl – Ssaki280 Miliony lat wstecz do wspólnego przodka

16 Pierwsze drzewa molekularne Walter M. Fitch, Emanuel Margoliash Science, 155: 279 (1967)

17 Korzeń – wspólny przodek Grupa monofiletyczna, naturalna (klad) Grupa parafiletyczna, nienaturalna Grupa polifiletyczna, nienaturalna Dwie grupy wywodzące się z jednego węzła to grupy siostrzane Drzewo składa się z gałęzi, węzłów i liści

18 mój brat cioteczny moja siostra cioteczna ja moja siostra moja mama moja babcia moja ciocia Moi krewni po kądzieli Grupa monofiletyczna – klad

19 Mysz, żaba, ćma, mucha, agawa i człowiek Homoagawa

20 Kręgowce i Czaszkowce Janvier (1996) wyłącza Śluzice z Kręgowców tworząc Czaszkowce Czaszkowce Kręgowce Krągłouste Śluzice Minogi Szczękowce Krągłouste nie są grupą naturalną

21 Gady i ptaki Ptaki Gady

22 Ichthyosauria Sauria są monofiletyczne, gady nie są ? Lepidosauria Jaszczurki węże Archosauria krokodyle ptaki dinozaury

23 Sauria Archosauria Lepidosauria Dinosauria

24 ? Elephantidae Trudno było ustalić pokrewieństwo mamuta na podstawie danych anatomicznych

25 Mitochondrialny genom mamuta Geny (żółte) i produkty cyklicznej polimerazy (niebieskie i pomarańczowe) Krause et al. (2006) Nature 439,

26 Fragment mitochon- drialnego genomu mamuta

27 Najbliżsi krewni mamuta Liczby przy węzłach wskazują na stopień zaufania do nich Rogaev et al. (2006) PLoS Biol. 4: e73

28 Copyright ©2002 by the National Academy of Sciences Arnason, Ulfur et al. (2002) Proc. Natl. Acad. Sci. USA 99, Najbliżsi krewni mamuta Najbliżsi krewni delfina Mitochondrialne pokrewieństwo ssaków Przystosowanie do życia w wodzie

29 Drzewo według Haeckela

30 Trzy domeny życia Carla Woesea Ja Agawa Dwa pierwotniaki

31 Drzewo SSU rRNA Popularne pod koniec ubiegłego wieku Trzy domeny Korona Eukaryota Chloroplasty i mitochondria są wśród bakterii Okazało się nieprawdziwe w kilku aspektach Sogin and Patterson 1995, zmienione chloroplasty mitochondria

32 Eukaryota SSU rRNA Sogin and Patterson, 1995 Są dwa nowe duże taksony Alweolaty i Stramenopile Zwierzęta i grzyby są grupami siostrzanymi Rośliny i ameby są parafiletyczne Mikrosporidia znajdują się u podstawy drzewa

33 Niektóre, bardziej znane Stramenopile Brunatnice Różnowiciowce Okrzemki Lęgniowce Złotowiciowce

34 Alweolaty Otwornice Orzęski Tobołki Apikompleksa

35 Zielone (zielenice i rośliny wyższe), czerwone (krasnorosty) i sine (glaukofity) Powstały w wyniku pierwotnej endosymbiozy Są najprawdopodobniej monofiletyczne copyright © DW Freshwater Archaeplastida Rośliny

36 Wszyscy jesteśmy chimerami Chimera z Arezzo Doolittle (TIBS 1998)

37 You are what you eat Jesteś tym czym się żywisz Doolittle 1998 Charles F. Delwiche (1999) American Naturalist 154:S164–S177. Endosymbioza pierwotna Glaukofity Krasnorosty Zielenice mitochondrium sinica Linia zielona Linia czerwona

38 Endo- symbioza drugiego i trzeciego stopnia Delwiche (1999) Am. Nat. 154: S164 Eugleniny Chlorarachniophyta Endo- symbioza wtórna Krypto- monady Strameno- pile Tobołki 3-ciego stopnia Haptofity Endosymbioza

39 Mieszanina genomów w komórce eukariotycznej Niektóre Eukaryota utraciły mitochondria lecz zachowały geny mitochondrialne Inne utraciły chloroplasty lecz zachowały geny chloroplastowe Chloroplast MitochondriumHydrogenosom utrata genomu utrata Plastyd niefotosyntetyzujący fotosyntezy Endosymbioza wtórna Chloroplast drugorzędowy

40 Współczesne drzewo życia 6 głównych grup monofiletycznych60 linii ewolucyjnych Bacteria Archaea

41 Choanoflagellata Myxozoa Henneguya My opistokonty

42 Opistokont – tylnowiciowiec (Copeland, 1956) Drzewa filogenetyczne różnych genów łączą wiciowce kołnierzykowe ze zwierzętami Myxozoa to najprawdopodobniej zredukowane parzydełkowce Mikrosporydia to grzyby Śluzowce (Mycetozoa) to nasza grupa siostrzana Opisthokonta Metazoa Myxozoa Choanoflagellata Fungi Microsporidia Mycetozoa

43 Trzy królestwa Archeanów Słonolubne i metanogenne Euryarcheota Ciepłolubne Crenarcheota Korarcheota znane tylko w postaci sekwencji

44 Filo- genomika Drzewa oparte na zestawach genów powtarzalnych we wszystkich poznanych sekwencjach pełnych genomów Ciccarelli et al (2006) Science 311, 1283

45 Prosty schemat historii życia Domeny Królestwa Doolittle, Science 284, 2124 (1999)

46 Życie nie jest takie proste Doolittle, Science 284, 2124 (1999)


Pobierz ppt "Molekularna księga rodzaju O filogenetyce molekularnej, współczesnej nauce badania pokrewieństw miedzy organizmami Jan Kwiatowski Instytut Botaniki UW."

Podobne prezentacje


Reklamy Google