Pobieranie prezentacji. Proszę czekać

Pobieranie prezentacji. Proszę czekać

Antygeny otrzymane T. gondiiw Katedrze Mikrobiologii Antygeny otrzymane T. gondii w Katedrze Mikrobiologii.

Podobne prezentacje


Prezentacja na temat: "Antygeny otrzymane T. gondiiw Katedrze Mikrobiologii Antygeny otrzymane T. gondii w Katedrze Mikrobiologii."— Zapis prezentacji:

1 Antygeny otrzymane T. gondiiw Katedrze Mikrobiologii Antygeny otrzymane T. gondii w Katedrze Mikrobiologii

2 Diagnostyka toksoplazmozy Metody diagnostyczne powinny: potwierdzić lub wykluczyć zarażenie T. gondii; określić fazę zarażenia (toksoplazmoza wczesna, przewlekła); u kobiet w ciąży z pierwotną toksoplazmozą potwierdzić lub wykluczyć zarażenie płodu lub noworodka METODY BEZPOŚREDNIE (mają na celu izolację pasożyta lub wykrycie jego antygenu) POŚREDNIE (wykorzystują właściwości immunogenne pasożyta)

3 Testy serologiczne stosowane w diagnostyce toksoplazmozy Test barwny (antygen żywy / IgG) Immunofluorescencja pośrednia (antygen utrwalony formaliną / IgG, IgM) Aglutynacja bezpośrednia (antygen utrwalony formaliną / IgG + IgM) Test ISAGA (antygen utrwalony formaliną / IgM, IgA, IgE) Odczyn wiązania dopełniacza (antygen cytoplazmatyczny / IgG + IgM) Test hemaglutynacji (antygen cytoplazmatyczny + błonowy / IgG + IgM) Test ELIFA (antygen cytoplazmatyczny / IgG, IgM, IgA, IgE) Awidność przeciwciał (antygen cytoplazmatyczny + błonowy / IgG) Test ELISA: pośredni (antygen cytoplazmatyczny + błonowy / IgG) bezpośredni (antygen cytoplazmatyczny + błonowy / IgM i IgA)

4 ekson 1 ekson 2 ekson 3 ekson 4 Schemat reakcji PCR (amplifikacja DNA genu bag1) ex1 ex2 PCR pz ex3 ex4 PCR pz ex4 PCR pz ex3 PCR pz

5 Konstrukcja plazmidu rekombinantowego ex1 ex2 MCS pUC pz EcoRI SmaI EcoRI Produkt PCR 1 EcoRI / SmaI pUC19/ex1ex pz HindIII Produkt PCR 4 ex3 ex4 SmaI / HindIII pUC19/BAG pz CCT CCC CCC GGG Pro Pro Pro SmaI

6 Konstrukcja plazmidu rekombinantowego MCS pUET pz BglII HindIII Klonowanie do wektora ekspresyjnego pUET1 w miejsca restrykcyjne BglII i HindIII DNA produktu PCR BglII / HindIII bag1 ( 694 pz) pUET1/BAG pz pUC19/BAG pz

7 Immunoidentyfikacja i oczyszczanie rekombinantowego białka BAG1 Rys. (A) Wynik testu Western blotting z użyciem przeciwciał skierowanych na domenę S-Tag; (B) Rozdział elektroforetyczny białek zawartych we frakcjach zebranych lizatów w 12% żelu poliakrylamidowym (SDS-PAGE); (C) Rozdział elektroforetyczny białek zawartych we frakcjach uzyskanych podczas oczyszczania białka rekombinantowego BAG1 w 12% żelu poliakrylamidowym (SDS-PAGE). M (A) M (B) M (C)

8 RODZINANAZWAFORMA ROZMOJOWA MARKERTEST Antygeny powierzchniowe (SAG) SAG1-His SAG2-His SAG4-His P35-His BSR4-His tachyzoit tachyzoit / bradyzoit bradyzoit tachyzoit bradyzoit w / p późna wczesna późna ELISA / Western b. Western blotting Antygeny granul o dużej gęstości (GRA) GRA1-His GRA2-His / GRA2ex2 GRA4-His GRA5-His / GRA5-Trx GRA6-His GRA7-His GRA9-His tachyzoit / bradyzoit wczesna ELISA / Western b. Western blotting ELISA / Western b. Western blotting Antygeny roptrii (ROP) ROP1-His ROP9-His tachyzoit / bradyzoit tachyzoit wczesna nie badano ELISA / Western b. - Antygeny mikronem (MIC) MIC1-His MIC3-His / MIC3-Trx tachyzoit / bradyzoit wczesna Western blotting Enzymy LDH1-His LDH2-His tachyzoit bradyzoit nie badano ---- Inne MAG1-His BAG1-His bradyzoit wczesna późna ELISA / Western b. Western blotting

9 Test Western blotting IgM +, IgG + / niska awidność Toksoplazmoza wczesna (ostra) IgM +, IgG + / wysoka awidność Toksoplazmoza przewlekła ??? IgM -, IgG >300 IU/ml / wysoka awidność Toksoplazmoza przewlekła IgM -, IgG 48 IU/ml / wysoka awidność Toksoplazmoza przewlekła M M – marker wielkości 1 – MAG1 2 – GRA5 3 – GRA9 4 – GRA4

10 Test Western blotting M M – marker wielkości 1 – MIC3 2 – MAG1 3 – SAG4 4 – p35 IgM +, IgG + / niska awidność Toksoplazmoza wczesna (ostra) IgM -, IgG >300 IU/ml / wysoka awidność Toksoplazmoza przewlekła

11 Test Western blotting M M – marker wielkości 1 – MAG1 2 – p35 3 – SAG4 M PACJENT 1 pobranie surowicy TOKSOPLAZMOZA WCZESNA 2 pobranie surowicy (8 miesięcy później) TOKSOPLAZMOZA PÓŹNA

12 DNA szczepionki

13 Charakterystyka szczepionek Ściśle zdefiniowany skład zawierają geny kodujące określone antygeny białkowe lub sekwencje kodujące determinanty antygenowe Bezpieczeństwo brak możliwości wywołania infekcji możliwość wywołania choroby autoimmunologicznej indukcja produkcji autoprzeciwciał skierowanych przeciwko komórkom, w których następuje biosynteza obcego antygenu możliwość integracji DNA plazmidowego z ludzkim DNA Skuteczność wywołują zarówno humoralną jak i komórkową odpowiedź immunologiczną uzależniona od rodzaju kodowanego antygenu uzależniona od poziomu ekspresji antygenu w komórce docelowej

14 DNA szczepionki Charakterystyka szczepionek możliwość stosowania tylko jednej dawki szczepionki długotrwała prezentacja antygenu systemowi immunologicznemu – biosynteza antygenu in vivo możliwość stosowania jako szczepionki profilaktyczne lub terapeutyczne ochrona przed infekcją stymulacja układu immunologicznego u osobników zainfekowanych możliwość stosowania u niemowląt posiadających jeszcze matczyne przeciwciała DNA plazmidowe nie jest rozpoznawane i neutralizowane przez przeciwciała długotrwała prezentacja antygenu umożliwia rozwój prawidłowej odpowiedzi immunologicznej możliwość wywoływania odporności na różne szczepy tego samego wirusa lub bakterii możliwość wywołania odpowiedzi immunologicznej przeciwko bardziej zakonserwowanym antygenom niż antygeny powierzchniowe

15 DNA szczepionki Charakterystyka szczepionek Możliwość stosowania jako szczepionki skojarzone lub poliwalentne kilka plazmidów kodujących różne antygeny jeden plazmid kodujący kilka antygenów Możliwość dostarczania DNA do organizmu różnymi sposobami Łatwa formulacja szczepionek brak konieczności stosowania adiuwantów, substancji konserwujących i stabilizujących Stabilność termiczna liofilizowane lub sprecypitowane DNA można bardzo długo przechowywać w temperaturze pokojowej Niski koszt produkcji możliwość produkcji dużych ilości plazmidowego DNA w komórkach bakteryjnych łatwa i tania procedura oczyszczania plazmidowego DNA - liza alkaliczna

16 DNA szczepionki Sposoby formulacji i podawania szczepionek DNA domięśniowo (iniekcja; DNA w roztworze soli fizjologicznej) wydajność dostarczania DNA wzrasta, jeżeli jest podawane do regenerujących się mięśni śródskórnie (iniekcja; DNA w roztworze soli fizjologicznej) dożylnie (iniekcja, DNA wewnątrz liposomów) przez błony śluzowe donosowo; DNA w roztworze soli fizjologicznej, w postaci aerozolu doustnie; mikrokapsułki z biodegradowalnych polimerów zawierające DNA przez skórę skaryfikacja; DNA w roztworze soli fizjologicznej dostarczanie za pomocą pistoletu genowego, cząsteczki złota opłaszczone DNA (DNA dostarczane bezpośrednio do wnętrza komórek)

17 DNA szczepionki bakteryjne ori replikacji zapewnia dużą liczbę kopii plazmidowego DNA w komórce bakteryjnej prokariotyczny marker selekcyjny umożliwia łatwą identyfikację komórek bakteryjnych transformowanych DNA plazmidowym miejsce wielokrotnego klonowania (MCS) umożliwia łatwe wprowadzenie genu kodującego antygen w obręb DNA plazmidowego Wektory plazmidowe stosowane do produkcji DNA szczepionek (wektory wahadłowe)

18 DNA szczepionki elementy regulujące transkrypcję w organizmach eukariotycznych elementy regulujące transkrypcję w organizmach eukariotycznych silne promotory pochodzenia eukariotycznego lub wirusowegosilne promotory pochodzenia eukariotycznego lub wirusowego promotor CMV ludzkiego wirusa cytomegalii promotor CMV ludzkiego wirusa cytomegalii promotor SV40 małpiego wirusa S40 promotor SV40 małpiego wirusa S40 promotor CKM mięśniowo-specyficznej kinazy kreatyny promotor CKM mięśniowo-specyficznej kinazy kreatyny eukariotyczne lub wirusowe terminatory transkrypcji zapewniające poliadenylację mRNAeukariotyczne lub wirusowe terminatory transkrypcji zapewniające poliadenylację mRNA sygnał poliadenylacji wirusa S40 sygnał poliadenylacji wirusa S40 sygnał poliadenylacji bydlęcego hormonu wzrostu (BGH) sygnał poliadenylacji bydlęcego hormonu wzrostu (BGH) Wektory plazmidowe stosowane do produkcji DNA szczepionek (wektory wahadłowe)

19 Odpowiedź immunologiczna indukowana przez szczepionki DNA

20 DNA szczepionki Możliwości zwiększenia skuteczności szczepionek DNA zwiększenie poziomu ekspresji genu kodującego antygen nowe silne promotory promotory tkankowo-specyficzne sekwencja Kozaka inicjacji translacji w komórkach eukariotycznych ( -6 GCCAGCCAUGGG +4 ) codon usage – stosowanie kodonów preferowanych przez komórki ssacze multimeryzacja genu kodującego antygen zwiększenie immunogenności DNA szczepionki wprowadzenie do wektora plazmidowego immunogennych sekwencji CpG koekspresja antygenu z cząsteczkami immunostymulującymi

21 Szczepionki DNA poddawane próbom klinicznym Patogen Kodowane białko Odpowiedź humoralna Odpowiedź komórkowa HIV gp160, białka regulatorowe, białka rdzenia, enzymy nie badano + HBVHBsAg++ HSV glikoproteina HSV w ocenie wirus grypy hemaglutynina w ocenie Plasmodium sp. CSP, Spf66 nie badano +

22 Metody genotypowe najczęściej stosowane w badaniach epidemiologicznych Makrorestrykcyjna analiza genomowego DNA połączona z elektroforezą pulsacyjną (REA/PFGE) Multilocus Sequence Typing (MLST) Mikromacierze DNA Analiza polimorfizmu długości fragmentów restrykcyjnych amplifikowanego DNA (PCR/RFLP) Repetytywny ekstrageniczny palindromowy PCR (Rep-PCR) Przypadkowe amplifikowanie polimorficznego DNA (RAPD) Rybotypowanie Metody oparte o ligację adaptorów Z wymienionych największą moc dyskryminacyjną mają techniki polegające na analizie całego materiału genetycznego komórki

23 Złoty standard w typowaniu mikroorganizmów Analiza restrykcyjna chromosomalnego DNA połączona z elektroforezą pulsową (RFLP-PFGE) Technika ta polega na poddaniu nienaruszonego DNA genomowego trawieniu enzymatycznemu z zastosowaniem restryktaz. Rozdziału otrzymanych fragmentów restrykcyjnych dokonuje się w agarozowej elektroforezie pulsowej (ang. PFGE – Pulsed Field Gel Elektrophresis). Analiza polimorfizmu długości fragmentów restrykcyjnych możliwa dzięki elektroforezie pulsowej jest obecnie metodą standardową w epidemiologii szpitalnej.

24 Trudna w wykonaniu, kosztowna, wymaga skomplikowanej aparatury i zachowania stałych warunków analizy. Krawczyk, B., Lewandowski, K., Bronk, M., Samet, A., Myjak, P., Kur, J.: Evaluation of a novel method based on amplification of DNA fragments surrounding rare restriction sites (ADSRRS fingerprinting) for typing strains of vancomycin-resistant Enterococcus faecium. J. Microbiol. Meth. 52 (2003)

25 Cechy efektywnej metody typowania szczepów: Wysoki stopień dyskryminacji Powtarzalność Zdolność do typowania wszystkich szczepów Prosta w użyciu Szybkość Mało kosztowna Wystandaryzowana Potrzeba poszukiwania nowych metod typowania genetycznego, które powinny charakteryzować się prostotą wykonania, porównywalną siłą dyskryminacji do RFLP/PFGE, niskimi kosztami oraz łatwością adaptacji do badań rutynowych

26 METODY FINGERPRINTING Wiele obecnie stosowanych technik typowania molekularnego opiera się na analizie całego genomowego DNA analizę restrykcyjną amplifikację fragmentów DNA in vitro, przy zastosowaniu reakcji PCR Rozdział powstałych fragmentów DNA o różnej długości uzyskuje się przy pomocy technik elektroforetycznych. Otrzymany w ten sposób profil prążków jest charakterystyczny zarówno dla wybranej metody jak i dla badanej próby. Różnice we wzorach świadczą o odmienności genetycznej badanych organizmów. Metody te wykorzystują:

27 wzór elektroforetyczny = odcisk palca

28 Metody typowania molekularnego oparte na technice ang. Ligation Mediated PCR AFLP- Amplified Fragment Length Polymorphism, AFLP- Amplified Fragment Length Polymorphism, IRS- PCR – Infrequent Restriction Site PCR, IRS- PCR – Infrequent Restriction Site PCR, ADSRRS- fingerprinting – Amplification of DNA Fragments Surrounding Rare Restriction Sites ADSRRS- fingerprinting – Amplification of DNA Fragments Surrounding Rare Restriction Sites PCR- MP – PCR Melting Profiles. PCR- MP – PCR Melting Profiles.

29 LM PCR (ang. Ligation – Mediated Polimerase Chain Reaction) Technika ta umożliwia analizę całego genomowego DNA zarówno prokariotycznego jak i eukariotycznego, bez potrzeby znajomości jego sekwencji Etapy: trawienie restrykcyjne ligacja adaptorów reakcja pre –PCR reakcja PCR elektroforeza produktów amplifikacji

30 - 5 P 5 - P - 5 P 5 - P - 5 P 5 - P Trawienie restrykcyjne GATCC G CCTAG G G GGATC C G G C CTAG G G

31 - 5 P 5 - P Ligacja adaptorów oligonukleotydowych GATC CTAG - 5 CTAG 5 - CTAG

32 P 5 - P Ligacja adaptorów oligonukleotydowych GATC CTAG

33 P P Ligacja adaptorów oligonukleotydowych GATC CTAG

34 Ligacja adaptorów oligonukleotydowych GATC CTAG

35 Reakcja pre - PCR GATC CTAG

36 Reakcja PCR GATC CTAG

37 Elektroforeza w żelu poliakrylamidowym 1 2 3

38 Td [ºC]

39 Td [ºC]

40 PCR MP – PCR Melting Profile Ograniczoną reprezentację genomu można otrzymać stosując LM PCR z niższą niż zwykle temperaturą denaturacji w trakcie reakcji PCR

41 Wady: Termocykler gradientowy; Kalibracja termocyklera; PCR MP- cechy Zalety: Metoda nie wymaga znajomości analizowanej sekwencji; Prosta analiza wyników rozdziału w żelu poliakryloamidowym wybarwionych bromkiem etydyny; Ten sam adaptor i enzym restrykcyjny może być użyty do analizy DNA różnych gatunków organizmów; Wysoki potencjał różnicujący; Metoda szybka i stosunkowo tania ; Bardzo dobra powtarzalność uzyskiwanych wyników;

42 Gradient temperatury denaturacji Wybór odpowiedniej temperatury denaturacji PCR MP - PCR Melting Profile Etap wstępny 87,7 o C

43 PCR MP w wykrywaniu zakażeń szpitalnych na poszczególnych oddziałach szpitala Krawczyk, B., Samet, A., Leibner, J., Śledzińska, A., Kur, J.: Evaluation of a PCR melting profile (PCR MP) technique for bacterial strain differentiation. J. Clin. Microbiol. 44 (2006) H2

44 PCR MP w badaniu indywidualnego pacjenta Sytuacja epidemiologiczna indywidualnego pacjenta Nr pacjenta DataMateriałGenotyp krewH krewH krewH krewH kałH kałH krewH kałH krewH krewH krewH krewH krewH krewH krewH krewH24

45 Co to jest translokacja bakterii? migracja bakterii pochodzących z prawidłowej flory bakteryjnej i ich toksyn przez ścianę przewodu pokarmowego i układu moczowego, co w konsekwencji może wywoływać bakteriemię, zakażenia narządowe, a nawet posocznicę oraz zapalenie otrzewnej u chorych z marskością wątroby. PCR MP w badaniu indywidualnego pacjenta Badanie transmisji (translokacji) bakterii

46

47 Gradient temperatury denaturacji Potwierdzenie pokrewieństwa genetycznego PCR MP w badaniu indywidualnego pacjenta Badanie transmisji (translokacji) bakterii

48 Optymalizacja procedury PCR MP dla Enterococcus faecium Optymalizacja - cykl badań, który pozwoli określić parametry krytyczne poszczególnych etapów metody oraz wyznaczyć ich wartości optymalne Cel optymalizacji: skrócenie czasu przeprowadzania badania zmniejszenie stopnia skomplikowania przeprowadzania badania obniżenie kosztów analizy z zachowaniem jakości i powtarzalności otrzymywanych wyników

49 Podczas optymalizacji PCR MP badano wpływ zmiany: ilości, rodzaju i stężenia stosowanych odczynników czasu trwania poszczególnych etapów temperatury poszczególnych etapów na jakość otrzymywanych wyników W wyniku optymalizacji PCR MP określono: parametry krytyczne metody wartości optymalne badanych parametrów Izolacja genomowego DNA Enterococcus faecium Trawienie restrykcyjne genomowego DNA Reakcja ligacji Inaktywacja termiczna Reakcja PCR Elektroforeza poliakrylamidowa Wizualizacja

50 Wyznaczenie parametrów krytycznych M Rys.1. Obraz elektroforetyczny produktów PCR, przy zastosowaniu różnej ilości enzymu restrykcyjnego w reakcji trawienia; M – marker wielkości DNA (100 – 1000), K- kontrola ujemna, 0.1 – 10 –ilości enzymu w kolejnych próbach Rys.2. Obraz elektroforetyczny produktów PCR, przy zastosowaniu różnej ilości mieszaniny ligacyjnej; M – marker wielkości DNA (100 – 1000), K- kontrola ujemna, 0.2 – 10 – objętość mieszaniny ligacyjnej w kolejnych próbach [ul] M K- Wyznaczenie aktywności enzymu restrykcyjnego Wyznaczenie ilości mieszaniny ligacyjnej w reakcji PCR

51 1h; 37°C 500 ng DNA 5U HindIII 20 min; 37°C ng DNA 3U Hind III 1h, 16°C adaptor: 20pmol każdego oligonukleotydu 1U ligazaT4 20min; 16°C adaptor: 10pmol każdego oligonukleotydu 0,6U ligazaT4 10 min; 70°C Vc= 25 μl mieszanina ligacyjna 1μl starter 25 pmol Polimeraza PwoHis 0.6 U Cykle: 22 Procedura skrócona (wg Krawczyk B., Samet A., Leibner. J, Śledzińska A. Kur J. (2006); Procedura zoptymalizowana 10 min; 70°C Vc= 25 μl mieszanina ligacyjna 1μl starter 25 pmol Polimeraza PwoHis 0.6 U Cykle: 22 Izolacja genomowego DNA Enterococcus faecium Trawienie restrykcyjne genomowego DNA Reakcja ligacji Inaktywacja termiczna Reakcja PCR Elektroforeza poliakrylamidowa Wizualizacja

52 Weryfikacja zoptymalizowanej procedury PCR MP M M Analiza porównawcza pięciu różnych szczepów E. faecium Procedura standardowa Procedura zoptymalizowanaParametr Skrócona procedura PCR MP Zoptymalizowan a procedura PCR MP czas badania 8 h8 h8 h8 h6-7h koszt badania ? Zredukowany ze względu na zmniejszenie ilości stosowanych odczynników jakość otrzymywanyc h wyników bardzo dobra interpretacja wyników łatwałatwa

53 Konstrukcja zestawu diagnostycznego PCR MP unique Zestaw diagnostyczny PCR MP unique wykorzystuje zoptymalizowaną technikę PCR MP Służy do różnicowania i genotypowania drobnoustrojów w badaniach epidemiologicznych Zestaw pozwala na przeprowadzenie 100 pełnych analiz, przy zastosowaniu gotowych do użycia odczynników o stężeniach i aktywnościach odpowiadającym optymalnym

54 Walidacja zestawu diagnostycznego PCR MP unique Walidacja dowolnej metody badawczej jest to działanie mające na celu potwierdzenie w sposób udokumentowany i zgodny z założeniami, że dana metoda badawcza jest odpowiednia dla zamierzonego celu i pozwala uzyskać zaplanowane (prawidłowe) wyniki z odpowiednią precyzją i dokładnością. Walidacja przeprowadzona zgodnie z wytycznymi ICH (The International Conferencer on Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use) oraz monografii EP (European Pharmacopeia) dla metod analitycznych, wykorzystujących techniki amplifikacji kwasów nukleinowych (NAT – Nucleic Acid Amplification Techniques)

55 Cechy walidowane: specyficzność i selektywność granica wykrywalności elastyczność powtarzalność precyzja otrzymywanych wyników

56 Precyzja oznaczeń wykonanych przez tą samą osobę w tym samym laboratorium na tej samej aparaturze oraz z wykorzystaniem tych samych odczynników w krótkim odstępie czasu M K- M K- M K Precyzja Stopień zgodności otrzymanych wyników, gdy dana procedura jest stosowana dla wielokrotnie powtórzonych, niezależnych oznaczeń. Miarą precyzji jest stopień zgodności profili elektroforetycznych produktów reakcji PCR otrzymanych na drodze niezależnych badań tego samego szczepu. powtarzalność odtwarzalność Precyzja oznaczeń wykonywanych przez: inną osobę w tym samym laboratorium stosując te same odczynniki i aparaturę

57 Walidacja zestawu diagnostycznego PCR MP unique - podsumowanie Zoptymalizowana procedura PCR MP jest: specyficzna selektywna charakteryzuje się granicą oznaczalności DNA w ilości 250 ng elastyczna uniwersalna

58 ADSRRS fingerprinting (ang. Amplification of DNA Surrounding Rare Restriction Sites) Zjawisko supresji

59 Badania relacji epidemiologicznych pomiędzy nosicielstwem Staphylococcus aureus a czyracznością (metoda ADSRRS) Numer izolatu Oznaczenie rodziny/pacjenta Źródło izolacji PCR MP genotyp 1I/AnosA 2I/BnosA 3I/BczyrakA 4II/AnosB 5II/AczyrakB 6II/BnosC 7III/AnosD 8III/BczyrakB 9III/BnosD 10III/Bczyrak (pacha) B 11IV/AnosE 12IV/BnosF 13IV/BczyrakF

60 Nowa klasa homodimerycznych białek SSB z rodziny Deinococcaceae /Thermaceae – charakterystyka molekularna, zastosowanie

61 są niezbędne w procesie replikacji DNA stymulują polimerazy DNA oddziaływują z innymi białkami replikacyjnymi (np. helikazą) biorą udział w rekombinacji i naprawie DNA Funkcje białek SSB Występowanie białek SSB wszystkie żywe organizmy wirusy mitochondria SSB (ang. single stranded DNA - binding protein) białka wiążące się z jednoniciowym DNA

62 Klasyfikacja białek SSB ze względu na budowę homotetramer: - większość bakterii - mitochondria heterotrimer: - archaea - eukaryota dimer: - Thermus thermophilus (263 aa) - Thermus aquaticus (264 aa) - Deinococcus radiodurans (301 aa)

63 Termostabilność TaqSSB i TthSSB Termostabilność białek TaqSSB i TthSSB w T = 85ºC okres półtrwania wynosi 10 min T.aquaticus i T. thermophilus rosną w optymalnej temp. 70ºC

64 Termostabilność DgeoSSB i DmurSSB DgeoSSB 61,93 kDa monomer: 300 aa DmurSSB 49,51kDa monomer: 276 aa

65 Zastosowanie białek TaqSSB i TthSSB w reakcji PCR…i nie tylko…

66 Zastosowanie białek TaqSSB i TthSSB Reakcje PCR Reakcja multipleks PCR Reakcje sekwencjonowania trudnych matryc Odwrotna transkrypcja (RT) Inne techniki wykorzystujące ssDNA i RNA Zastosowanie dowiedzione Zastosowanie potencjalne Legenda: Aplikacje białek SSB

67 Wykorzystaliśmy białko TthSSB i TaqSSB do amplifikacji fragmentu DNA wirusa CMV. Reakcja PCR – jedną z najbardziej popularnych aplikacji termostabilnych białek SSB Rozdział elektroforetyczny w 2% żelu agarozowym produktów reakcji PCR przeprowadzanej w nieobecności TthSSB (góra) lub z białkiem TthSSB (dół). Powyżej ścieżek wskazano liczbę cząsteczek DNA (pCDNA21/CMV) w każdej amplifikowanej próbce. Rezultat: TthSSB podnosi wydajność reakcji PCR o 4 rzędy wielkości

68 Wykorzystanie białka TaqSSB w reakcji multipleks PCR Hybryd utworzony przez startery DYS390 i DYS392 Krótkie tandemowe sekwencje repetytywne występujące w ludzkim chromosomie Y (Y- STR) wykazują wysoki stopień polimorfizmu i są znacznikiem różnicującym osobniki. Analiza polimorfizmu ludzkiego Y-STR umożliwia ustalenie ojcostwa i jest szeroko stosowana w laboratoriach medycyny sądowej. Loci DYS390, DYS392 i DYS393 występujące w Y-STR są dobrym markerem różnicującym W Zakładzie Medycyny Sądowej AM Gdańsk badano wpływ białka TaqSSB na amplifikację multiplex PCR z dimeryzacją starterów. Do badania wpływu białka TaqSSB na efektywność amplifikacji układu wybrano amplifikację dupleksu DYS390-DYS392, w której dimeryzacja starterów zachodzi w trakcie procesu i powstaje nieprawidłowy produkt PCR długości 36 pz, uniemożliwiający syntezę właściwych produktów PCR w standardowych warunkach starter DYS390 starter DYS390 starter DYS

69 M – wzorzec wielkości DNA (pGEM, Promega) 1 - produkty amplifikacji ze starterami C-A+TaqSSB 2 - produkty amplifikacji ze starterami C-A 3 - produkty amplifikacji ze starterami C-B+TaqSSB 4 - produkty amplifikacji ze starterami C-B 5 - produkty amplifikacji ze starterami A-B+TaqSSB 6 - produkty amplifikacji ze starterami A-B 7 - produkty amplifikacji ze starterami A-B-C+TaqSSB 8 - produkty amplifikacji ze starterami A-B-C Startery DYS390 = A Startery DYS392 = B Startery DYS393 = C Wynik reakcji multiplex PCR

70 Wnioski dotyczące reakcji PCR DYS390, DYS392 i DYS393 Startery DYS390 i DYS392 tworzą bardzo stabilną hybrydę, łącząc się ze sobą na 3 końcach, do których polimeraza dosyntetyzowuje nukleotydy i tworzy się dodatkowy produkt o wielkości 36 pz. Na podstawie przeprowadzonego doświadczenia można wnioskować, że dodatek termostabilnego białka SSB uniemożliwia tworzenie się struktur drugorzędowych, zarówno wewnątrzcząsteczowych, jak i międzycząsteczkowych, dzięki czemu, uzyskuje się większą wydajność reakcji PCR, a tym samym pozwala na uzyskanie oczekiwanego produktu reakcji PCR.

71 Wpływ białka TaqSSB na reakcję PCR M – marker wielkości M – reakcja bez białka TaqSSB 2 – reakcja z dodatkiem 6 l białka TaqSSB 3 – reakcja z dodatkiem 8 l białka TaqSSB 4 – reakcja z dodatkiem 9 l białka TaqSSB 5 – reakcja z dodatkiem 10 l białka TaqSSB 6 – reakcja z dodatkiem 11 l białka TaqSSB 7 – reakcja z dodatkiem 12 l białka TaqSSB 8 – reakcja z dodatkiem 14 l białka TaqSSB stężenie białka TaqSSB – 1.12 g/ l Dodatek innych znanych wzmacniaczy reakcji PCR jak np.: EcoSSB/Formamid/TMAC/DMSO/TritonX-100 nie przyniósł satysfakcjonujących rezultatów !!! Wynik reakcji PCR modelowego układu, w którym startery wiążą się ze sobą na końcach 3 5 CGACGATTCTGAGTACTTGCA 3 3 AGACTCATGAACGTAGCAGCA 5


Pobierz ppt "Antygeny otrzymane T. gondiiw Katedrze Mikrobiologii Antygeny otrzymane T. gondii w Katedrze Mikrobiologii."

Podobne prezentacje


Reklamy Google