Pobieranie prezentacji. Proszę czekać

Pobieranie prezentacji. Proszę czekać

Ekspresja wybranych genów ARF w elementach kwiatów odpadających i nieodpadających łubinu żółtego ( Lupinus luteus ) Milena Kulasek (1), Paulina Glazińska.

Podobne prezentacje


Prezentacja na temat: "Ekspresja wybranych genów ARF w elementach kwiatów odpadających i nieodpadających łubinu żółtego ( Lupinus luteus ) Milena Kulasek (1), Paulina Glazińska."— Zapis prezentacji:

1 Ekspresja wybranych genów ARF w elementach kwiatów odpadających i nieodpadających łubinu żółtego ( Lupinus luteus ) Milena Kulasek (1), Paulina Glazińska (1), Jacek Kęsy (1), Jan Kopcewicz (1) Łubin żółty (Lupinus luteus) jest ważną rośliną użytkową. Jednym z głównych problemów związanych z jego uprawą jest odpadanie znacznej części kwiatów, w wyniku czego tylko niewielka ich część (ok. 20%) przekształca się w dojrzałe strąki (Rys. 1). Z danych literaturowych wiadomo, że u Arabidopsis w tym procesie uczestniczy auksyna [1], m.in. poprzez aktywność szlaku transdukcji sygnału auksyny. Transdukcja sygnału auksynowego obejmuje szereg reakcji, w wyniku których następuje odpowiedź rośliny na fitohormon, co prowadzić może między innymi do zmian fizjologicznych w roślinie. W skład szlaku wchodzi białko F-box kompleksu SCF (z ang. SKP1-Cullin-F- box-RBX1) z receptorem auksyn z rodziny TAAR (TIR1/AFB AUXIN RECEPTOR), a mianowicie TRANSPORT INHIBITOR RESPONSE 1 (TIR1) i jego homologi AUXIN SIGNALING F- BOX PROTEIN (AFB), białka AUX/IAA oraz czynniki transkrypcyjne AUXIN RESPONSE FACTOR (ARF) (Rys. 2). Wiadomo, że u Arabidopsis w proces odcinania jest zaangażowany gen ARF2 [2]. Celem przedstawionych badań jest określenie, czy i które geny ARF są zaangażowane w to zjawisko u łubinu żółtego. (1) Katedra Fizjologii Roślin i Biotechnologii, Uniwersytet Mikołaja Kopernika w Toruniu Materiał do analiz aktywności genów ARF stanowiły kwiaty łubinu żółtego uprawianego w warunkach polowych, zebrane osobno z dolnych okółków (kwiaty nieodpadające) i z górnych okółków (kwiaty odpadające). Kwiaty rozdzielono na poszczególne części (płatki, kielich, dno, pręciki i słupki) i natychmiast zamrożono w ciekłym azocie, a następnie zhomogenizowano. Izolacja całkowitego RNA została przeprowadzona za pomocą zestawu Isolate II RNA Plant kit (Bioline). Odwrotna transkrypcja została przeprowadzona za pomocą zestawu TRANSCRIPTME RNA kit (DNA Gdansk). Reakcja Real-Time PCR została przeprowadzona z wykorzystaniem starterów i sond przedstawionych w Tab. 1, oraz zestawu Probe Fast qPCR Kit (KAPA) master mix i termocyklera LightCycler 480 (Roche). Genem referencyjnym był gen kodujący aktynę (ACT). Rys. 1. Problem nadmiernego odpadania kwiatów: poniżej 50% kwiatów rozwija się w strąki, z których tylko 30% pozostaje na roślinie i rozwija się w duże strąki zawierające dojrzałe nasiona. Rys. 2. Schemat obrazujący zasadę działania ścieżki transdukcji sygnału auksyny, za pomocą którego wyzwalana jest odpowiedź genetyczna na ten fitohormon. [1] Basu, M.M., Gonzales-Carranza, Z.H., Azam-Ali, S., Tang, S., Shahid, A.A., Roberts, J.A. (2013) The manipulation of auxin in the abscission zone cells of Arabidopsis flowers reveals that indoleacetic acid signaling is a prerequisite for organ sheding, Plant Physiology, 162(1): [2] Ellis, C.M., Nagpal, P., Young, J.C., Hagen, G., Guilfoyle, T.J., Reed, J.W. (2005) AUXIN RESPONSE FACTOR1 and AUXIN RESPONSE FACTOR2 regulate senescence and floral organ abscission in Arabidopsis thaliana, Development, 132: Praca finansowana w ramach grantu indywidualnego dla doktorantów UMK 2567-B. GenStartery Sonda UPL lewyprawy ARF2GGCCCTCTACCTAACCCTGTCATGGACTACTACCTACCACATTGA#155 ARF6GCTGTGCTGTTTATCTGGAATGTCACAGTTTGTGGTCGATTTG#142 ARF8GGCCACATACCAAATTACCCAATATTGTGAAGTTGGCAAATCAA#97 ACTTGGACGTACTACAGGTATTGTGCATGGGCACTGTATGGCTCAC#9 Tab. 1. Wykaz starterów i sond UPL (typu Taq-Man) użyta do przeprowadzenia reakcji RT-qPCR do analizy ekspresji wybranych genów ARF łubinu żółtego. Profil aktywności genów ARF2, ARF6 i ARF8 w różnych częściach kwiatów nieodpadających i odpadających jest inny (Rys. 3). Taki wynik wskazuje na ich zaangażowanie w regulacje odpadania lub utrzymywania organów generatywnych łubinu. Rys. 3. Wykresy przedstawia- jące wyniki reakcji RT- qPCR dla genów: ARF2 (po lewej), ARF6 (w środku) i ARF8 (po prawej). Wstęp i cel badań Materiały i metody Wyniki i wnioski Referencje i źródło finansowania


Pobierz ppt "Ekspresja wybranych genów ARF w elementach kwiatów odpadających i nieodpadających łubinu żółtego ( Lupinus luteus ) Milena Kulasek (1), Paulina Glazińska."

Podobne prezentacje


Reklamy Google